Human OLFML2A cDNA Clone BC054001 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL731560HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLFML2A
Gene ID:
169611
Accession #:
BC054001
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OLFML2A cDNA Clone BC054001 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OLFML2A

Gene ID: 169611

Accession Number: BC054001

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTAAGAGAGACAAGGCTGGGAAGGACACAGCTAGAGGAAAAGGCAAGGACATCAGCAAGTATGGCAGTGTGCAGAAAAGCTTTGCAGACAGAGGCCTCCCAAAACCTCCCAAGGAGAAGCTGCTTCAGGTGGAGAAGCTGAGAAAGGAGAGCGGCAAGGGCAGTTTCCTCCAGCCCACAGCCAAGCCCCGCGCCCTGGCCCAGCAGCAGGCTGTGATCCGGGGCTTCACCTACTACAAGGCAGGCAAGCAGGAGGTGACCGAGGCGGTGGCAGACAACGCCCTCCAGGGCACTTCCTGGCTGGAGCAACTGCCGCCCAAGGTGGAGGGCAGGTCCAACTCCGCAGAGCCCAACTCCGCAGAGCAGGATGAGGCTGAGCCCAGGTCCTCCGAGCGAGTGGACCTGGCTTCTGGCACCCCCACTTCAATCCCTGCCACCACCACCACCGCCACCACCACCCCAACCCCCACCACCAGTCTCCTGCCCACCGAGCCACCTTCAGGTCCAGAAGTCTCCAGCCAAGGCAGAGAGGCGAGCTGTGAGGGCACCCTCCGGGCTGTGGACCCCCCTGTGAGGCACCACAGCTATGGGCGCCACGAGGGAGCCTGGATGAAGGACCCTGCAGCTCGAGACGACAGGATCTATGTCACCAACTACTACTATGGAAACAGCCTGGTGGAGTTCCGCAACCTGGAAAACTTCAAGCAAGGCCGCTGGAGTAACATGTACAAGCTACCCTACAACTGGATCGGCACAGGCCACGTGGTGTACCAGGGCGCCTTCTACTACAACCGCGCCTTCACCAAGAACATCATCAAGTACGACCTACGGCAGCGCTTCGTGGCCTCCTGGGCGCTGCTGCCCGACGTGGTATATGAGGACACCACACCTTGGAAGTGGCGCGGACACTCGGACATTGACTTTGCCGTGGACGAGAGCGGCCTGTGGGTCATCTACCCCGCCGTGGACGACCGCGATGAGGCCCAGCCCGAGGTGATCGTCCTGAGTCGCTTGGACCCCGGCGATCTCTCCGTGCACCGGGAGACCACGTGGAAGACACGGCTGCGGCGGAACTCCTACGGGAACTGCTTCCTGGTGTGCGGCATCCTGTATGCCGTGGACACGTACAACCAGCAGGAAGGCCAGGTCGCCTACGCTTTCGACACGCACACGGGCACCGACGCACGCCCCCAGCTGCCGTTCCTCAACGAGCACGCCTACACCACCCAGATCGACTACAACCCCAAGGAGCGGGTGCTGTACGCCTGGGACAATGGCCACCAGCTCACCTACACCCTCCACTTCGTGGTCTGA

Length: 1317

View AllClose

0 Reviews

View AllClose