Human OLFM2 cDNA Clone BC011361 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016321HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLFM2
Gene ID:
93145
Accession #:
BC011361
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human OLFM2 cDNA Clone BC011361 pENTR223.1 Plasmid | Cusabio

Gene Name: OLFM2

Gene ID: 93145

Accession Number: BC011361

Vector: pENTR223.1

Sequence: ATGTGGCCGCTCACGGTCCCGCCGCCGCTGCTGCTGCTGCTGTGCTCAGGCCTGGCCGGACAGACTCTCTTCCAGAACCCAGAAGAGGGCTGGCAGCTGTACACCTCAGCCCAGGCCCCTGACGGGAAATGCATCTGCACGGCCGTGATCCCAGCGCAGAGTACCTGCTCTCGAGATGGCAGGAGTCGGGAGCTGCGGCAACTGATGGAGAAGGTCCAGAACGTCTCCCAGTCCATGGAGGTCCTTGAGTTGCGGACGTATCGCGACCTCCAGTATGTACGCGGCATGGAGACCCTCATGCGGAGCCTGGATGCGCGGCTCCGGGCAGCTGATGGGTCCCTCTCGGCCAAGAGCTTCCAGGAGCTGAAGGACAGGATGACGGAACTGTTGCCCCTGAGCTCGGTCCTGGAGCAGTACAAGGCAGACACGCGGACCATTGTACGCTTGCGGGAGGAGGTGAGGAATCTCTCCGGCAGTCTGGCGGCCATTCAGGAGGAGATGGGTGCCTACGGGTATGAGGACCTGCAGCAACGGGTGATGGCCCTGGAGGCCCGGCTCCACGCCTGCGCCCAGAAGCTGGGCTGTGGGAAGCTGACCGGGGTCAGTAACCCCATCACCGTTCGGGCCATGGGGTCCCGCTTCGGCTCCTGGATGACTGACACGATGGCCCCCAGTGCGGATAGCCGGGTCTGGTACATGGATGGCTATTACAAAGGCCGCCGGGTCCTGGAGTTCCGTACCCTGGGAGACTTCATCAAAGGCCAGAACTTTATCCAGCACCTGCTGCCCCAGCCGTGGGCGGGCACGGGCCACGTGGTGTACAACGGCTCCCTGTTCTATAACAAGTACCAGAGCAACGTGGTGGTCAAATACCACTTCCGCTCGCGCTCTGTGCTGGTGCAGAGGAGCCTCCCGGGCGCCGGTTACAACAACACCTTCCCCTACTCCTGGGGCGGCTTCTCCGACATGGACTTCATGGTGGACGAGAGCGGGCTCTGGGCTGTGTACACCACCAACCAGAACGCGGGCAACATCGTGGTCAGCCGGCTGGACCCGCACACCCTCGAGGTCATGCGGTCCTGGGACACCGGCTACCCCAAGCGCAGCGCTGGCGAGGCCTTCATGATCTGCGGTGTGCTCTACGTGACCAACTCCCACCTGGCTGGGGCCAAGGTCTACTTCGCCTATTTTACCAACACGTCCAGTTACGAGTACACGGACGTGCCCTTCCACAACCAGTATTCCCACATCTCGATGCTGGATTACAACCCCCGGGAGCGCGCCCTCTATACCTGGAACAACGGCCACCAGGTGCTCTACAATGTCACCCTGTTTCACGTCATCAGCACCTCTGGGGACCCCTGA

Length: 1365

View AllClose

0 Reviews

View AllClose