Human OLFM1 cDNA Clone BC008763 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL858725HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLFM1
Gene ID:
10439
Accession #:
BC008763
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OLFM1 cDNA Clone BC008763 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OLFM1

Gene ID: 10439

Accession Number: BC008763

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCAGGTCGTTGGAGGTGGCAGCGAGACATGCACCCGGCCCGGAAGCTCCTCAGCCTCCTCTTCCTCATCCTGATGGGCACTGAACTCACTCAAGTGCTGCCCACCAACCCTGAGGAGAGCTGGCAGGTGTACAGCTCTGCCCAGGACAGCGAGGGCAGGTGTATCTGCACAGTGGTCGCCCCACAGCAGACCATGTGTTCACGGGATGCCCGCACAAAACAGCTGAGGCAGCTACTGGAGAAGGTGCAGAACATGTCTCAATCCATAGAGGTCTTGGACAGGCGGACCCAGAGAGACTTGCAGTACGTGGAGAAGATGGAGAACCAAATGAAAGGACTGGAGTCCAAGTTCAAACAGGTGGAGGAGAGTCATAAGCAACACCTGGCCAGGCAGTTTAAGGCGATAAAAGCGAAAATGGATGAACTTAGGCCTTTGATACCTGTGTTGGAAGAGTACAAGGCCGATGCCAAATTGGTATTGCAGTTTAAAGAGGAGGTCCAGAATCTGACGTCAGTGCTTAACGAGCTGCAAGAGGAAATTGGCGCCTATGACTACGATGAACTTCAGAGCAGAGTGTCCAATCTTGAAGAAAGGCTCCGTGCATGCATGCAAAAACTAGCTTGCGGGAAGTTGACGGGCATCAGTGACCCCGTGACTGTCAAGACCTCCGGCTCGAGGTTCGGATCCTGGATGACAGACCCTCTCGCCCCTGAAGGCGATAACCGGGTGTGGTACATGGACGGCTATCACAACAACCGCTTCGTACGTGAGTACAAGTCCATGGTTGACTTCATGAACACGGACAATTTCACCTCCCACCGTCTCCCCCACCCCTGGTCGGGCACGGGGCAGGTGGTCTACAACGGTTCTATCTACTTCAACAAGTTCCAGAGCCACATCATCATCAGGTTTGACCTGAAGACAGAGACCATCCTCAAGACCCGCAGCCTGGACTATGCCGGTTACAACAACATGTACCACTACGCCTGGGGTGGCCACTCGGACATCGACCTCATGGTGGACGAGAGCGGGCTGTGGGCCGTGTACGCCACCAACCAGAACGCTGGCAACATCGTGGTCAGTAGGCTGGACCCCGTGTCCCTGCAGACCCTGCAGACCTGGAACACGAGCTACCCCAAGCGCAGCGCCGGGGAGGCCTTCATCATCTGCGGCACGCTGTACGTCACCAACGGCTACTCAGGGGGTACCAAGGTCCACTATGCATACCAGACCAATGCCTCCACCTATGAATACATCGACATCCCATTCCAGAACAAATACTCCCACATCTCCATGCTGGACTACAACCCCAAGGACCGGGCCCTGTATGCCTGGAACAACGGCCACCAGATCCTCTACAACGTGACCCTCTTCCACGTCATCCGCTCCGACGAGTTGTAG

Length: 1404

View AllClose

0 Reviews

View AllClose