Human OLAH cDNA Clone BC050372 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL878894HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLAH
Gene ID:
55301
Accession #:
BC050372
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OLAH cDNA Clone BC050372 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OLAH

Gene ID: 55301

Accession Number: BC050372

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGAGAGGAGACCAACCTAAGAGAACCAGGAATGAAAACATTTTCAACTGCTTATACAAAAACCCTGAGGCAACTTTTAAGCTGATTTGCTTTCCCTGGATGGGAGGTGGCTCCACTCATTTTGCCAAATGGGGCCAAGATACTCATGATTTGCTGGAAGTGCACTCCTTAAGGCTTCCTGGAAGAGAAAGCAGAGTTGAAGAACCTCTTGAAAATGACATCTCCCAGTTAGTTGATGAAGTTGTTTGTGCTCTGCAGCCAGTCATCCAGGATAAACCATTTGCATTTTTTGGCCACAGTATGGGATCCTACATTGCTTTTAGGACTGCACTAGGTCTAAAAGAAAACAATCAACCAGAACCATTGCATTTATTTTTGTCAAGTGCAACTCCTGTACATTCAAAGGCCTGGCATCGCATTCCCAAAGATGATGAATTGTCAGAAGAACAAATAAGTCATTACCTTATGGAATTTGGAGGCACCCCCAAGCATTTTGCTGAAGCCAAGGAATTTGTGAAACAATGTAGTCCCATCATAAGGGCAGATCTGAACATTGTTAGAAGTTGCACCTCTAACGTACCATCTAAGGCTGTTCTTTCCTGTGACTTGACATGTTTTGTTGGATCTGAAGACATAGCAAAGGACATGGAAGCCTGGAAAGATGTAACCAGTGGAAATGCTAAAATTTACCAGCTTCCAGGGGGTCACTTTTATCTTCTGGATCCTGCGAACGAGAAATTAATCAAGAACTACATAATCAAGTGTCTAGAAGTATCATCGATATCCAATTTTTAG

Length: 798

View AllClose

0 Reviews

View AllClose