Human OLA1 cDNA Clone BC013925 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016318HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLA1
Gene ID:
29789
Accession #:
BC013925
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OLA1 cDNA Clone BC013925 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OLA1

Gene ID: 29789

Accession Number: BC013925

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCCCTAAAAAGGGAGGTGATGGAATTAAACCACCCCCAATCATTGGAAGATTTGGAACCTCACTGAAAATTGGTATTGTTGGATTGCCAAATGTTGGGAAATCTACTTTCTTCAATGTGTTAACCAATAGTCAGGCTTCAGCAGAAAACTTCCCGTTCTGCACTATTGATCCTAATGAGAGCAGAGTACCTGTGCCAGATGAAAGGTTTGACTTTCTTTGTCAATACCACAAACCAGCAAGCAAAATTCCTGCCTTTCTAAATGTGGTGGATATTGCTGGCCTTGTGAAAGGAGCTCACAATGGGCAGGGCCTGGGGAATGCTTTTTTATCTCATATTAGTGCCTGTGATGGCATCTTTCATCTAACACGTGCTTTTGAAGATGATGATATCACGCACGTTGAAGGAAGTGTAGATCCTATTCGAGATATAGAAATAATACATGAAGAGCTTCAGCTTAAAGATGAGGAAATGATTGGGCCCATTATAGATAAACTAGAAAAGGTGGCTGTGAGAGGAGGAGATAAAAAACTAAAACCTGAATATGATATAATGTGCAAAGTAAAATCCTGGGTTATAGATCAAAAGAAACCTGTTCGCTTCTATCATGATTGGAATGACAAAGAGATTGAAGTGTTGAATAAACACTTATTTTTGACTTCAAAACCAATGGTCTACTTGGTTAATCTTTCTGAAAAAGACTACATTAGAAAGAAAAACAAATGGCTGCTGGAAAGTACAGACAACAAGGCAGAAATTATATTGTTGAAGATGGAGATATTATCTTCTTCAAATTTAACACACCTCAACAACCGAAGAAGAAATAAAATTTAG

Length: 837

View AllClose

0 Reviews

View AllClose