Human ODF3 cDNA Clone BC126222 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL847205HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF3
Gene ID:
113746
Accession #:
BC126222
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ODF3 cDNA Clone BC126222 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ODF3

Gene ID: 113746

Accession Number: BC126222

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACGGAGGAGGTATGGATGGGTACCTGGAGACCCCATCGCCCCCGGGGACCCATCATGGCCCTCTACAGCAGCCCTGGACCCAAGTACCTGATTCCACCAACAACAGGCTTCATGAAGCACACGCCCACCAAGCTGCGTGCACCGGCCTACAGCTTCCGTGGGGCCCCCATGCTCCTGGCAGAGAACTGCTCCCCAGGGCCCCGTTACAATGTAAACCCCAAGATACTGAGGACTGGCAAGGACCTTGGCCCTGCCTACTCCATCCTGGGGCGCTACCAAACCAAGACCATGCTGACTCCTGGTCCAGGTGACTACTTTCCAGAGAAATCCACCAAGTACGTGTTCGACTCAGCACCCAGCCACTCCATCTCTGCCCGGACAAAGGCATTCCGAGTGGACAGCACCCCAGGCCCCGCTGCGTACATGCTGCCCATGGTAATGGGGCCCAATACCGTCGGCAAGGCCTCCCAGCCCTCCTTTTCCATCAAGGGCCGCAGCAAGCTGGGCGGCTTCAGCGACGACCTACACAAGACCCCAGGTCCCGCAGCCTACCGCCAAACTGATGTGCGGGTGACCAAGTTCAAGGCTCCGCAGTACACCATGGCTGCCCGTGTGGAGCCCCCAGGGGACAAGACCCTCAAGCCAGGACCAGGCGCCCACAGCCCTGAGAAGGTGACCCTGACCAAGCCCTGCGCCCCAGTTGTCACCTTCGGCATCAAACACTCTGATTACATGACTCCCCTGCTGGTTGATGTGGAATAA

Length: 765

View AllClose

0 Reviews

View AllClose