Human ODC1 cDNA Clone BC025296 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016269HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODC1
Gene ID:
4953
Accession #:
BC025296
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ODC1 cDNA Clone BC025296 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ODC1

Gene ID: 4953

Accession Number: BC025296

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACAACTTTGGTAATGAAGAGTTTGACTGCCACTTCCTCGATGAAGGTTTTACTGCCAAGGACATTCTGGACCAGAAAATTAATGAAGTTTCTTCTTCTGATGATAAGGATGCCTTCTATGTGGCAGACCTGGGAGACATTCTAAAGAAACATCTGAGGTGGTTAAAAGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGTAATGATAGCAAAGCCATCGTGAAGACCCTTGCTGCTACCGGGACAGGATTTGACTGTGCTAGCAAGACTGAAATACAGTTGGTGCAGAGTCTGGGGGTGCCTCCAGAGAGGATTATCTATGCAAATCCTTGTAAACAAGTATCTCAAATTAAGTATGCTGCTAATAATGGAGTCCAGATGATGACTTTTGATAGTGAAGTTGAGTTGATGAAAGTTGCCAGAGCACATCCCAAAGCAAAGTTGGTTTTGCGGATTGCCACTGATGATTCCAAAGCAGTCTGTCGTCTCAGTGTGAAATTCGGTGCCACGCTCAGAACCAGCAGGCTCCTTTTGGAACGGGCGAAAGAGCTAAATATCGATGTTGTTGGTGTCAGCTTCCATGTAGGAAGCGGCTGTACCGATCCTGAGACCTTCGTGCAGGCAATCTCTGATGCCCGCTGTGTTTTTGACATGGGGGCTGAGGTTGGTTTCAGCATGTATCTGCTTGATATTGGCGGTGGCTTTCCTGGATCTGAGGATGTGAAACTTAAATTTGAAGAGATCACCGGCGTAATCAACCCAGCGTTGGACAAATACTTTCCGTCAGACTCTGGAGTGAGAATCATAGCTGAGCCCGGCAGATACTATGTTGCATCAGCTTTCACGCTTGCAGTTAATATCATTGCCAAGAAAATTGTATTAAAGGAACAGACGGGCTCTGATGACGAAGATGAGTCGAGTGAGCAGACCTTTATGTATTATGTGAATGATGGCGTCTATGGATCATTTAATTGCATACTCTATGACCACGCACATGTAAAGCCCCTTCTGCAAAAGAGACCTAAACCAGATGAGAAGTATTATTCATCCAGCATATGGGGACCAACATGTGATGGCCTCGATCGGATTGTTGAGCGCTGTGACCTGCCTGAAATGCATGTGGGTGATTGGATGCTCTTTGAAAACATGGGCGCTTACACTGTTGCTGCTGCCTCTACGTTCAATGGCTTCCAGAGGCCGACGATCTACTATGTGATGTCAGGGCCTGCGTGGCAACTCATGCAGCAATTCCAGAACCCCGACTTCCCACCCGAAGTAGAGGAACAGGATGCCAGCACCCTGCCTGTGTCTTGTGCCTGGGAGAGTGGGATGAAACGCCACAGAGCAGCCTGTGCTTCGGCTAGTATTAATGTGTAG

Length: 1386

View AllClose

0 Reviews

View AllClose