Human OCIAD2 cDNA Clone BC032808 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL704099HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OCIAD2
Gene ID:
132299
Accession #:
BC032808
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OCIAD2 cDNA Clone BC032808 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OCIAD2

Gene ID: 132299

Accession Number: BC032808

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTTCAGCGTCTGCTCGTGGAAACCAAGATAAAGATGCCCATTTTCCACCACCAAGCAAGCAGAGCCTGTTGTTTTGTCCAAAATCAAAACTGCACATCCACAGAGCAGAGATCTCAAAGATTATGCGAGAATGTCAGGAAGAAAGTTTCTGGAAGAGAGCTCTGCCTTTTTCTCTTGTAAGCATGCTTGTCACCCAGGGACTAGTCTACCAAGGTTATTTGGCAGCTAATTCTAGATTTGGATCATTGCCCAAAGTTGCACGCACTGCCTCCTTACCTGTGAGGAATGCAAAATAA

Length: 300

View AllClose

0 Reviews

View AllClose