null

Human OAZ1 cDNA Clone BC093652 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016245HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAZ1
Gene ID:
4946
Accession #:
BC093652
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OAZ1 cDNA Clone BC093652 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OAZ1

Gene ID: 4946

Accession Number: BC093652

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGAAATCCTCCCTGCAGCGGATCCTCAATAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGATAAACCCAGCGCCACCATCCACGCCAGCCGCACCATGCCGCTCCTAAGCCTGCACAGCCGCGGCGGCAGCAGCAGTGAGAGTTCCAGGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGA

Length: 207

View AllClose

0 Reviews

View AllClose