Human LFNG cDNA Clone BC014851 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL839868HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LFNG
Gene ID:
3955
Accession #:
BC014851
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LFNG cDNA Clone BC014851 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LFNG

Gene ID: 3955

Accession Number: BC014851

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACACCAGGTCGCTGCTGTCTTGCGGCTGACATTCAGGTAGAGACGTTCATCTTCACTGACGGGGAAGATGAGGCCCTGGCCAGGCACACGGGCAACGTGGTCATCACAAACTGCTCGGCCGCCCACAGCCGCCAGGCGCTGTCCTGCAAGATGGCCGTGGAGTATGACCGCTTCATCGAGTCCGGCAGGAAGTGGTTCTGCCACGTGGACGATGACAACTACGTCAACCTGCGGGCCCTGCTGCGGCTGCTGGCCAGCTACCCGCACACGCGGGACGTCTACGTCGGCAAGCCCAGCCTGGACAGGCCCATCCAGGCCATGGAGCGGGTCAGCGAGAACAAGGTGCGTCCTGTCCACTTCTGGTTTGCCACGGGCGGCGCTGGCTTCTGCATCAGCCGTGGGCTGGCTCTGAAGATGAGCCCGTGGGCCAGCGGGGGTCACTTCATGAATACGGCTGAGCGGATCCGGCTGCCTGATGACTGCACCATCGGCTACATCGTGGAGGCCCTGCTGGGTGTGCCCCTCATCCGCAGCGGCCTCTTCCACTCCCACCTGGAGAACCTGCAGCAGGTGCCCACCTCGGAGCTCCACGAGCAGGTGACGCTGAGCTACGGTATGTTTGAAAACAAGCGGAACGCCGTCCACGTGAAGGGGCCCTTCTCGGTGGAGGCCGACCCATCCAGGTTCCGCTCCATCCACTGCCACCTGTACCCGGACACACCCTGGTGTCCCCGCACTGCCATCTTCTAG

Length: 753

View AllClose

0 Reviews

View AllClose