Human LETMD1 cDNA Clone BC064943 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL757554HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LETMD1
Gene ID:
25875
Accession #:
BC064943
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LETMD1 cDNA Clone BC064943 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LETMD1

Gene ID: 25875

Accession Number: BC064943

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGCTCTCCAGGGTGTGCTGGGCTCGGTCGGCTGTGTGGGGCTCGGCAGTCACCCCTGGACATTTTGTCACCCGGAGGCTGCAACTTGGTCGCTCTGGCCTGGCTTGGGGGGCCCCTCGGTCTTCAAAGCTTCACCTTTCTCCAAAGGCAGATGTGAAGAACTTGATGTCTTATGTGGTAACCAAGACAAAAGCGATTAATGGGAAATACCATCGTTTCTTGGGTCGTCATTTCCCCCGCTTCTATGTCCTGTACACAATCTTCATGAAAGGATTGCAGATGTTATGGGCTGATGCCAAAAAGGCTAGAAGAATAAAGACAAATATGTGGAAGCACAATATAAAGTTTCATCAACTTCCATACCGGGAGATGGAGCATTTGAGACAGTTCCGCCAAGACGTCACCAAGTGTCTTTTCCTAGGTATTATTTCCATTCCACCTTTTGCCAACTACCTGGTCTTCTTGCTAATGTACCTGTTTCCCAGGCAACTACTGATCAGGCATTTCTGGACCCCAAAACAACAAACTGATTTCTTAGATATCTATCATGCTTTCCGGAAGCAGTCCCACCCAGAAATTATTAGTTATTTAGAAAAGGTCATCCCTCTCATTTCTGATGCAGGACTCCGGTGGCGTCTGACAGATCTGTGCACCAAGATACAGCGTGGTACCCACCCAGCAATACATGATATCTTGGCTCTGAGAGAGTGTTTCTCTAACCATCCTCTGGGCATGAACCAACTCCAGGCTTTGCACGTGAAAGCCTTGAGCCGGGCCATGCTTCTCACATCTTACCTGCCTCCTCCCTTGTTGAGACATCGTTTGAAGACTCATACAACTGTGATTCACCAACTGGACAAGGCTTTGGCAAAGCTGGGGATTGGCCAGCTGACTGCTCAGGAAGTAAAATCGGCTTGTTATCTCCGTGGCCTGAATTCTACGCATATTGGTGAAGATAGGTGTCGAACTTGGCTGGGAGAATGGCTGCAGATTTCCTGCAGCCTGAAAGAAGCTGAGCTGTCTCTCTTGCTGCACAACGTGGTCCTGCTCTCCACCAACTACCTTGGGACAAGGCGCTGA

Length: 1083

View AllClose

0 Reviews

View AllClose