Human LETM1 cDNA Clone BC014500 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012877HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LETM1
Gene ID:
3954
Accession #:
BC014500
Plasmid:
pUC
€677.00
Frequently bought together:

Description

Human LETM1 cDNA Clone BC014500 pUC Plasmid | Cusabio

Gene Name: LETM1

Gene ID: 3954

Accession Number: BC014500

Vector: pUC

Sequence: ATGGCGTCCATCTTACTGAGGAGCTGCCGCGGCCGGGCGCCCGCCCGCCTCCCGCCGCCGCCTCGGTACACCGTCCCGCGGGGTAGTCCAGGGGATCCTGCTCATCTCAGCTGTGCCAGCACCCTGGGGTTGAGGAACTGCCTGAATGTTCCATTTGGCTGCTGCACTCCCATCCACCCTGTGTACACATCCTCCAGAGGCGATCACCTCGGCTGTTGGGCTCTGAGGCCCGAGTGCCTTCGCATAGTGTCGAGAGCGCCATGGACCTCTACCTCTGTGGGTTTTGTGGCTGTGGGACCTCAGTGCCTTCCTGTGCGTGGCTGGCACTCTTCGCGCCCTGTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAGTTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTGCCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCCACATTTGAGACTCAGTCACTCAAGGAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGACACCATCGAGGAGATGGCCTTGAAGAACAAGGCAGCCAAGGGCAGCGCCACCAAAGACTTCTCTGTGTTTTTCCAGAAGATCCGGGAAACAGGGGAGAGGCCCAGCAATGAGGAAATCATGCGTTTTTCCAAATTATTTGAGGATGAGCTGACCCTGGACAACCTGACACGGCCGCAGCTGGTGGCCCTGTGCAAGCTGCTGGAGCTACAGTCCATCGGCACCAACAACTTCCTGCGCTTCCAGCTTACCATGCGGCTGCGCTCCATAAAGGCAGACGACAAGCTGATTGCTGAGGAAGGGGTGGACAGCCTGAATGTCAAGGAGCTGCAGGCAGCGTGTCGGGCACGAGGCATGCGGGCCCTGGGCGTCACGGAAGACCGCCTGAGGGGTCAGCTGAAGCAGTGGCTGGACCTGCACCTGCATCAGGAGATCCCCACATCGCTGCTCATCCTGTCCCGGGCCATGTACCTCCCGGACACCCTCTCTCCAGCCGACCAGCTCAAGTCCACACTGCAGACCCTCCCAGAGATTGTGGCAAAGGAAGCACAGGTGAAAGTGGCCGAGGTGGAGGGCGAGCAGGTGGACAACAAGGCCAAGCTGGAGGCCACGCTGCAGGAGGAGGCGGCCATCCAGCAGGAGCACCGTGAGAAGGAGCTGCAGAAGCGCTCGGAGGTGGCGAAGGATTTTGAGCCCGAACGTGTGGTAGCTGCTCCCCAAAGGCCGGGGACCGAGCCACAGCCAGAAATGCCTGACACAGTCCTGCAGTCAGAGACCTTGAAGGACACTGCCCCGGTGCTGGAGGGCTTGAAGGAGGAAGAGATCACGAAGGAGGAAATCGACATCCTCAGCGATGCCTGCTCTAAGCTGCAGGAGCAGAAGAAGTCACTCACCAAGGAGAAGGAGGAGCTGGAGCTGCTGAAGGAGGATGTGCAGGACTACAGCGAGGACTTGCAGGAGATCAAGAAGGAACTTTCAAAGACTGGTGAAGAAAAATACGTGGAAGAATCTAAAGCCAGCAAGAGATTGACAAAAAGGGTGCAGCAAATGATCGGGCAGATCGATGGCTTGATCTCGCAGCTGGAGATGGACCAGCAGGCTGGCAAGCTGGCCCCGGCCAACGGCATGCCCACGGGGGAGAACGTCATCAGTGTCGCTGAGCTCATCAACGCCATGAAGCAAGTCAAGCACATTCCCGAAAGCAAGCTCACCAGCCTGGCCGCAGCACTGGATGAAAACAAGGATGGCAAGGTCAACATCGACGACCTCGTCAAGGTGATTGAGCTGGTGGACAAAGAAGATGTTCACATCTCCACCAGCCAGGTGGCTGAGATTGTAGCAACACTGGAAAAAGAGGAGAAGGTGGAGGAGAAGGAGAAGGCCAAAGAGAAGGCAGAGAAGGAGGTCGCAGAGGTGAAGAGCTAG

Length: 2220

View AllClose

0 Reviews

View AllClose