Human LEP cDNA Clone BC069323 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012870HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEP
Gene ID:
3952
Accession #:
BC069323
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LEP cDNA Clone BC069323 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LEP

Gene ID: 3952

Accession Number: BC069323

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGCCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGA

Length: 504

View AllClose

0 Reviews

View AllClose