Human LELP1 cDNA Clone BC130507 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL719414HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LELP1
Gene ID:
149018
Accession #:
BC130507
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LELP1 cDNA Clone BC130507 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LELP1

Gene ID: 149018

Accession Number: BC130507

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCGAGTGATGATAAAAGTAAATCAAATGACCCCAAGACTGAGCCCAAGAACTGCGATCCCAAGTGTGAACAAAAGTGTGAGTCCAAATGCCAGCCCAGCTGTTTAAAGAAGCTGCTGCAACGCTGTTTCGAAAAGTGCCCATGGGAAAAGTGTCCAGCACCACCCAAGTGCCTGCCCTGCCCCTCGCAGTCTCCTTCATCCTGCCCTCCCCAGCCCTGCACCAAGCCCTGTCCTCCTAAATGCCCTTCATCCTGCCCACATGCTTGCCCACCTCCCTGCCCTCCCCCAGAGTGA

Length: 297

View AllClose

0 Reviews

View AllClose