Human LDOC1L cDNA Clone BC018713 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL760786HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDOC1L
Gene ID:
84247
Accession #:
BC018713
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDOC1L cDNA Clone BC018713 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDOC1L

Gene ID: 84247

Accession Number: BC018713

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGCTCTTTAAGCGTGATCGGAGGGAAGACACACAGCAGGGCCACCATTCCATGAATGGGAGGTGTACAGATCACTTTCTCTTTGTGCTCAGTTCTGTTCTGTCTCCAGCAGCTATATTGGTAAGACTAGTACCTGCCAGGGAGAGGTGCCCCCAAGTGAAGGGGTACAGTGGCACCTGGGAAAAGGCACCTGGAAGGTTTCCATGTGGCCCAGCCCAGCATGGAAGCAGGGTGGGAACTCTGCTGTGTCGCCAGCGCTCACTCTACTCGAGTGGCTTTTTGAAAGCCCTACCATGTCTGTGTCAGGCCTGTGCTGCTTCACATCCTACAGCTGCCTAG

Length: 342

View AllClose

0 Reviews

View AllClose