Human LDHC cDNA Clone BC064388 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012844HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDHC
Gene ID:
3948
Accession #:
BC064388
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDHC cDNA Clone BC064388 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDHC

Gene ID: 3948

Accession Number: BC064388

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCAACTGTCAAGGAGCAGCTAATTGAGAAGCTAATTGAGGATGATGAAAACTCCCAGTGTAAAATTACTATTGTTGGAACTGGTGCCGTAGGCATGGCTTGTGCTATTAGTATCTTACTGAAGGATTTGGCTGATGAACTTGCCCTTGTTGATGTTGCATTGGACAAACTGAAGGGAGAAATGATGGATCTTCAGCATGGCAGTCTTTTCTTTAGTACTTCAAAGATTACTTCTGGAAAAGATTACAGTGTATCTGCAAACTCCAGAATAGTTATTGTCACAGCAGGTGCAAGGCAGCAGGAGGGAGAAACTCGCCTTGCCCTGGTCCAACGTAATGTGGCTATAATGAAATCAATCATTCCTGCCATAGTCCATTATAGTCCTGATTGTAAAATTCTTGTTGTTTCAAATCCAGTGGATATTTTGACATATATAGTCTGGAAGATAAGTGGCTTACCTGTAACTCGTGTAATTGGAAGTGGTTGTAATCTAGACTCTGCCCGTTTCCGTTACCTAATTGGAGAAAAGTTGGGTGTCCACCCCACAAGCTGCCATGGTTGGATTATTGGAGAACATGGTGATTCTAGTGTGCCCTTATGGAGTGGGGTGAATGTTGCTGGTGTTGCTCTGAAGACTCTGGACCCTAAATTAGGAACGGATTCAGATAAGGAACACTGGAAAAATATCCATAAACAAGTTATTCAAAGTGCCTATGAAATTATCAAGCTGAAGGGGTATACCTCTTGGGCTATTGGACTGTCTGTGATGGATCTGGTAGGATCCATTTTGAAAAATCTTAGGAGAGTGCACCCAGTTTCCACCATGGTTAAGGGATTATATGGAATAAAAGAAGAACTCTTTCTCAGTATCCCTTGTGTCTTGGGGCGGAATGGTGTCTCAGATGTTGTGAAAATTAACTTGAATTCTGAGGAGGAGGCCCTTTTCAAGAAGAGTGCAGAAACACTTTGGAATATTCAAAAGGATCTAATATTTTAA

Length: 999

View AllClose

0 Reviews

View AllClose