Human LDHB cDNA Clone BC002362 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012841HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDHB
Gene ID:
3945
Accession #:
BC002362
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LDHB cDNA Clone BC002362 pENTR223.1 Plasmid | Cusabio

Gene Name: LDHB

Gene ID: 3945

Accession Number: BC002362

Vector: pENTR223.1

Sequence: ATGGCAACTCTTAAGGAAAAACTCATTGCACCAGTTGCGGAAGAAGAGGCAACAGTTCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTTGGTATGGCGTGTGCTATCAGCATTCTGGGAAAGTCTCTGGCTGATGAACTTGCTCTTGTGGATGTTTTGGAAGATAAGCTTAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTATTCTGTGACCGCCAATTCTAAGATTGTAGTGGTAACTGCAGGAGTCCGTCAGCAAGAAGGGGAGAGTCGGCTCAATCTGGTGCAGAGAAATGTTAATGTCTTCAAATTCATTATTCCTCAGATCGTCAAGTACAGTCCTGATTGCATCATAATTGTGGTTTCCAACCCAGTGGACATTCTTACGTATGTTACCTGGAAACTAAGTGGATTACCCAAACACCGCGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGATTTCGCTACCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGGGAACATGGCGACTCAAGTGTGGCTGTGTGGAGTGGTGTGAATGTGGCAGGTGTTTCTCTCCAGGAATTGAATCCAGAAATGGGAACTGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCCTATGAAGTCATCAAGCTAAAAGGATATACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCCGTGTCAACAATGGTAAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTCAATGCCCGGGGATTAACCAGCGTTATCAACCAGAAGCTAAAGGATGATGAGGTTGCTCAGCTCAAGAAAAGTGCAGATACCCTGTGGGACATCCAGAAGGACCTAAAAGACCTGTGA

Length: 1005

View AllClose

0 Reviews

View AllClose