Human LCP1 cDNA Clone BC007673 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012824HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCP1
Gene ID:
3936
Accession #:
BC007673
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human LCP1 cDNA Clone BC007673 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCP1

Gene ID: 3936

Accession Number: BC007673

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCAGAGGATCAGTGTCCGATGAGGAAATGATGGAGCTCAGAGAAGCTTTTGCCAAAGTTGATACTGATGGCAATGGATACATCAGCTTCAATGAGTTGAATGACTTGTTCAAGGCTGCTTGCTTGCCTTTGCCTGGGTATAGAGTACGAGAAATTACAGAAAACCTGATGGCTACAGGTGATCTGGACCAAGATGGAAGGATCAGCTTTGATGAGTTTATCAAGATTTTCCATGGCCTAAAAAGCACAGATGTTGCCAAGACCTTTAGAAAAGCAATCAATAAGAAGGAAGGGATTTGTGCAATCGGTGGTACTTCAGAGCAGTCTAGCGTTGGCACCCAACACTCCTATTCAGAGGAAGAAAAGTATGCCTTTGTCAACTGGATAAACAAAGCCCTGGAAAATGATCCTGATTGTCGGCATGTCATCCCAATGAACCCAAACACGAATGATCTCTTTAATGCTGTTGGAGATGGCATTGTCCTTTGTAAAATGATCAACCTGTCAGTGCCAGACACAATTGATGAAAGAACAATCAACAAAAAGAAGCTAACCCCTTTCACCATTCAGGAAAATCTGAACTTGGCTCTGAACTCTGCCTCAGCCATCGGGTGCCATGTGGTCAACATAGGGGCTGAGGACCTGAAGGAGGGGAAGCCTTATCTGGTCCTGGGACTTCTGTGGCAAGTCATCAAGATTGGGTTGTTTGCTGACATTGAACTCAGCAGAAATGAAGCTCTGATTGCTCTTTTGAGAGAAGGTGAGAGCCTGGAGGATTTGATGAAACTCTCCCCTGAAGAGCTCTTGCTGAGGTGGGCTAATTACCACCTGGAAAATGCAGGCTGCAACAAAATTGGCAACTTCAGTACTGACATCAAGGACTCAAAAGCTTATTACCACCTGCTTGAGCAGGTGGCTCCAAAAGGAGATGAAGAAGGTGTTCCTGCTGTTGTTATTGACATGTCAGGACTGCGGGAGAAGGATGACATCCAGAGGGCAGAATGCATGCTGCAGCAGGCGGAGAGGCTGGGCTGCCGGCAGTTTGTCACAGCCACAGATGTTGTCCGAGGGAACCCCAAGTTGAACTTGGCTTTTATTGCCAACCTCTTTAACAGATACCCTGCCCTGCACAAACCAGAGAACCAGGACATTGACTGGGGGGCTCTTGAAGGTGAGACGAGAGAAGAGCGGACATTTAGGAACTGGATGAACTCCCTGGGTGTTAACCCTCGAGTCAATCATTTGTACAGTGACTTATCAGATGCCCTGGTCATCTTCCAGCTCTATGAAAAGATCAAAGTTCCTGTTGACTGGAACAGAGTAAACAAACCGCCATACCCCAAACTGGGAGGCAATATGAAGAAGCTTGAGAATTGTAACTACGCGGTAGAATTGGGGAAGAATCAAGCGAAGTTCTCCCTGGTTGGCATCGGTGGACAAGATCTCAATGAAGGAAACCGCACTCTCACACTGGCCTTGATTTGGCAGCTAATGAGAAGGTATACACTGAATATCCTCGAAGAAATTGGTGGTGGCCAGAAGGTCAATGATGACATTATTGTCAACTGGGTGAATGAAACATTGAGGGAAGCAGAGAAAAGTTCATCCATCTCTAGTTTCAAGGACCCGAAGATTAGTACAAGTCTGCCTGTTCTGGACCTCATCGATGCCATCCAACCAGGTTCCATTAACTATGACCTTCTGAAGACAGAAAATCTGAATGATGATGAGAAACTCAACAATGCAAAATATGCCATCTCTATGGCCCGAAAAATTGGAGCAAGAGTGTATGCCCTGCCAGAAGACCTGGTTGAAGTGAACCCCAAAATGGTCATGACCGTGTTTGCCTGCCTCATGGGGAAAGGAATGAAGAGGGTGTGA

Length: 1884

View AllClose

0 Reviews

View AllClose