Human LCE2D cDNA Clone BC130603 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL713134HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCE2D
Gene ID:
353141
Accession #:
BC130603
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LCE2D cDNA Clone BC130603 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCE2D

Gene ID: 353141

Accession Number: BC130603

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTTGCCAGCAAAACCAGCAGCAGTGCCAGCCCCCTCCCAAATGTCCTCCCAAGTGTACCCCAAAATGTCCACCTAAGTGTCCCCCCAAATGCCCACCACAGTGCCCAGCTCCATGTTCCCCTGCAGTCTCTTCCTGCTGTGGTCCCAGCTCTGGGAGCTGCTGTGGTCCCAGCTCTGGGGGCTGCTGCAGCTCTGGGGGTGGTGGCTGCTGCCTGAGCCACCACAGGCCCCGTCTCTTCCACCGGCGCCGGCACCAGAGCCCCGATTGCTGTGAGAGTGAACCTTCTGGGGCCTCTGGCTGCTGCCACAGCTCTGGGGGCTGCTGCTGA

Length: 333

View AllClose

0 Reviews

View AllClose