Human LCE2A cDNA Clone BC119707 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL719417HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCE2A
Gene ID:
353139
Accession #:
BC119707
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LCE2A cDNA Clone BC119707 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCE2A

Gene ID: 353139

Accession Number: BC119707

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCCTGCCAGCAAAACCAGCAGCAGTGCCAGCCCCCTCCCAAGTGCCCCCCAAAATGCCCACCCAAGTGTCCTCCAAAGTGCCGACCTCAGTGCCCAGCCCCATGCCCACCTCCAGTCTCTTCCTGCTGTGGTCCCAGCTCTGGGGGCTGCTGCGGCTCCAGCTCTGGGGGCTGCTGCAGCTCTGGGGGTGGCGGCTGCTGCCTGAGCCACCACAGGCCCCGTCTCTTCCACCGGCACCGGCACCAGAGCCCCGATTGTTGTGAGTGTGAACCTTCTGGGGGCTCTGGCTGCTGCCACAGCTCTGGGGACTGCTGCTGA

Length: 321

View AllClose

0 Reviews

View AllClose