null

Human LCAT cDNA Clone BC014781 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012783HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCAT
Gene ID:
3931
Accession #:
BC014781
Plasmid:
pUC
€444.00
Frequently bought together:

Description

Human LCAT cDNA Clone BC014781 pUC Plasmid | Cusabio

Gene Name: LCAT

Gene ID: 3931

Accession Number: BC014781

Vector: pUC

Sequence: ATGGGGCCGCCCGGCTCCCCATGGCAGTGGGTGACGCTGCTGCTGGGGCTGCTGCTCCCTCCTGCCGCCCCCTTCTGGCTCCTCAATGTGCTCTTCCCCCCGCACACCACGCCCAAGGCTGAGCTCAGTAACCACACACGGCCCGTCATCCTCGTGCCCGGCTGCCTGGGGAATCAGCTAGAAGCCAAGCTGGACAAACCAGATGTGGTGAACTGGATGTGCTACCGCAAGACAGAGGACTTCTTCACCATCTGGCTGGATCTCAACATGTTCCTACCCCTTGGGGTAGACTGCTGGATCGATAACACCAGGGTTGTCTACAACCGGAGCTCTGGGCTCGTGTCCAACGCCCCTGGTGTCCAGATCCGCGTCCCTGGCTTTGGCAAGACCTACTCTGTGGAGTACCTGGACAGCAGCAAGCTGGCAGGGTACCTGCACACACTGGTGCAGAACCTGGTCAACAATGGCTACGTGCGGGACGAGACTGTGCGCGCCGCCCCCTATGACTGGCGGCTGGAGCCCGGCCAGCAGGAGGAGTACTACCGCAAGCTCGCAGGGCTGGTGGAGGAGATGCACGCTGCCTATGGGAAGCCTGTCTTCCTCATTGGCCACAGCCTCGGCTGTCTACACTTGCTCTATTTCCTGCTGCGCCAGCCCCAGGCCTGGAAGGACCGCTTTATTGATGGCTTCATCTCTCTTGGGGCTCCCTGGGGTGGCTCCATCAAGCCCATGCTGGTCTTGGCCTCAGGTGACAACCAGGGCATCCCCATCATGTCCAGCATCAAGCTGAAAGAGGAGCAGCGCATAACCACCACCTCCCCCTGGATGTTTCCCTCTCGCATGGCGTGGCCTGAGGACCACGTGTTCATTTCCACACCCAGCTTCAACTACACAGGCCGTGACTTCCAACGCTTCTTTGCAGACCTGCACTTTGAGGAAGGCTGGTACATGTGGCTGCAGTCACGTGACCTCCTGGCAGGACTCCCAGCACCTGGTGTGGAAGTATACTGTCTTTACGGCGTGGGCCTGCCCACGCCCCGCACCTACATCTACGACCACGGCTTCCCCTACACGGACCCTGTGGGTGTGCTCTATGAGGATGGTGATGACACGGTGGCGACCCGCAGCACCGAGCTCTGTGGCCTGTGGCAGGGCCGCCAGCCACAGCCTGTGCACCTGCTGCCCCTGCACGGGATACAGCATCTCAACATGGTCTTCAGCAACCTGACCCTGGAGCACATCAATGCCATCCTGCTGGGTGCCTACCGCCAGGGTCCCCCTGCATCCCCGACTGCCAGCCCAGAGCCCCCGCCTCCTGAATAA

Length: 1323

View AllClose

0 Reviews

View AllClose