Human LAX1 cDNA Clone BC069650 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL811614HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAX1
Gene ID:
54900
Accession #:
BC069650
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LAX1 cDNA Clone BC069650 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAX1

Gene ID: 54900

Accession Number: BC069650

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCTTGCTGACTTTGCCACAAACCAGACAAAGAGCCAAAAATATTTATGACATCTTGCCTTGGCGACAGGAAGACCTGGGGAGACATGAGTCGAGGAGTATGCGCATTTTCAGTACTGAGAGCCTCCTCTCCAGAAATTCTGAGAGCCCGGAGCATGTGCCCTCCCAAGCAGGCAATGCCTTCCAGGAGCATACAGCCCACATCCATGCCACAGAGTACGCGGTGGGTATCTATGACAACGCCATGGTCCCCCAGATGTGTGGGAACCTCACTCCCTCGGCACACTGCATCAATGTCAGAGCTTCCAGAGACTGCGCAAGCATTTCTTCAGAGGATTCGCATGATTATGTCAATGTCCCCACAGCAGAAGAGATTGCTGAGACTCTAGCTTCTACCAAAAGCCCTTCCAGAAATCTCTTTGTTCTTCCCAGTACCCAGAAGCTGGAGTTTACTGAGGAAAGAGATGAGGGCTGTGGAGATGCTGGTGACTGCACCAGTTTGTATTCTCCAGGAGCTGAGGACAGTGATTCACTCAGCAATGGAGAAGGTTCTTCTCAGATCTCAAATGACTATGTCAACATGACAGGGTTGGATCTCAGTGCCATCCAGGAAAGGCAGCTCTGGGTGGCTTTTCAGTGCTGCAGAGACTATGAAAATGTTCCAGCAGCAGATCCCAGTGGAAGCCAGCAGCAGGCTGAGAAAGATGTGCCATCCTCAAACATAGGTCATGTCGAGGACAAGACAGATGATCCCGGGACCCATGTCCAATGTGTCAAAAGGACATTCCTTGCTTCAGGGGATTATGCAGACTTTCAGCCATTCACACAGAGTGAGGACAGTCAGATGAAACATAGAGAAGAGATGTCAAATGAGGACTCCAGTGACTATGAAAATGTGCTAACTGCCAAGTTAGGAGGCAGGGACTCTGAGCAGGGGCCTGGCACTCAGCTCCTTCCTGATGAATGA

Length: 969

View AllClose

0 Reviews

View AllClose