Human LAPTM4B cDNA Clone BC014129 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL774814HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAPTM4B
Gene ID:
55353
Accession #:
BC014129
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LAPTM4B cDNA Clone BC014129 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAPTM4B

Gene ID: 55353

Accession Number: BC014129

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGATGGTCGCGCCCTGGACGCGGTTCTACTCCAACAGCTGCTGCTTGTGCTGCCATGTCCGCACCGGCACCATCCTGCTCGGCGTCTGGTATCTGATCATCAATGCTGTGGTACTGTTGATTTTATTGAGTGCCCTGGCTGATCCGGATCAGTATAACTTTTCAAGTTCTGAACTGGGAGGTGACTTTGAGTTCATGGATGATGCCAACATGTGCATTGCCATTGCGATTTCTCTTCTCATGATCCTGATATGTGCTATGGCTACTTACGGAGCGTACAAGCAACGCGCAGCCTGGATCATCCCATTCTTCTGTTACCAGATCTTTGACTTTGCCCTGAACATGTTGGTTGCAATCACTGTGCTTATTTATCCAAACTCCATTCAGGAATACATACGGCAACTGCCTCCTAATTTTCCCTACAGAGATGATGTCATGTCAGTGAATCCTACCTGTTTGGTCCTTATTATTCTTCTGTTTATTAGCATTATCTTGACTTTTAAGGGTTACTTGATTAGCTGTGTTTGGAACTGCTACCGATACATCAATGGTAGGAACTCCTCTGATGTCCTGGTTTATGTTACCAGCAATGACACTACGGTGCTGCTACCCCCGTATGATGATGCCACTGTGAATGGTGCTGCCAAGGAGCCACCGCCACCTTACGTGTCTGCCTAA

Length: 681

View AllClose

0 Reviews

View AllClose