Human LAPTM4A cDNA Clone BC003158 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL621858HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAPTM4A
Gene ID:
9741
Accession #:
BC003158
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LAPTM4A cDNA Clone BC003158 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAPTM4A

Gene ID: 9741

Accession Number: BC003158

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGTCCATGAGTTTCAAGCGGAACCGCAGTGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATCATCCTGGGGACCTGGTACATGGTAGTAAACCTATTGATGGCAATTTTGCTGACTGTGGAAGTGACTCATCCAAACTCCATGCCAGCTGTCAACATTCAGTATGAAGTCATCGGTAATTACTATTCTTCTGAGAGAATGGCTGATAATGCCTGTGTTCTTTTTGCCGTCTCTGTTCTTATGTTTATAATCAGTTCAATGCTGGTTTATGGATCAATTTCTTATCAAGTGGGTTGGCTGATTCCATTCTTCTGTTACCGACTTTTTGACTTCGTCCTCAGTTGCCTGGTTGCTATTAGTTCTCTCACCTATTTGCCAAGAATCAAAGAATATCTGGATCAACTACCTGATTTTCCCTACAAAGATGACCTCCTGGCCTTGGACTCCAGCTGCCTCCTGTTCATTGTTCTTGTGTTCTTTGCCTTATTCATCATTTTTAAGGCTTATCTAATTAACTGTGTTTGGAACTGCTATAAATACATCAACAACCGAAACGTGCCGGAGATTGCTGTGTACCCTGCCTTTGAAGCACCTCCTCAGTACGTTTTGCCAACCTATGAAATGGCCGTGAAAATGCCTGAAAAAGAACCACCACCTCCTTACTTACCTGCCTGA

Length: 702

View AllClose

0 Reviews

View AllClose