Human LAMC2 cDNA Clone BC112286 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL618803HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMC2
Gene ID:
3918
Accession #:
BC112286
Plasmid:
pUC
€1,101.00
Frequently bought together:

Description

Human LAMC2 cDNA Clone BC112286 pUC Plasmid | Cusabio

Gene Name: LAMC2

Gene ID: 3918

Accession Number: BC112286

Vector: pUC

Sequence: ATGCCTGCGCTCTGGCTGGGCTGCTGCCTCTGCTTCTCGCTCCTCCTGCCCGCAGCCCGGGCCACCTCCAGGAGGGAAGTCTGTGATTGCAATGGGAAGTCCAGGCAGTGTATCTTTGATCGGGAACTTCACAGACAAACTGGTAATGGATTCCGCTGCCTCAACTGCAATGACAACACTGATGGCATTCACTGCGAGAAGTGCAAGAATGGCTTTTACCGGCACAGAGAAAGGGACCGCTGTTTGCCCTGCAATTGTAACTCCAAAGGTTCTCTTAGTGCTCGATGTGACAACTCCGGACGGTGCAGCTGTAAACCAGGTGTGACAGGAGCCAGATGCGACCGATGTCTGCCAGGCTTCCACATGCTCATGGATGCGGGGTGCACCCAAGACCAGAGACTGCTAGACTCCAAGTGTGACTGTGACCCAGCTGGCATCGCAGGGCCCTGTGACGCGGGCCGCTGTGTCTGCAAGCCAGCTGTCACTGGAGAACGCTGTGATAGGTGTCGATCAGGTTACTATAATCTGGATGGGGGGAACCCTGAGGGCTGTACCCAGTGTTTCTGCTATGGGCATTCAGCCAGCTGCCGCAGCTCTGCAGAATACAGTGTCCATAAGATCACCTCTACCTTTCATCAAGATGTTGATGGCTGGAAGGCTGTCCAACGAAATGGGTCTCCTGCAAAGCTCCAATGGTCACAGCGCCATCAAGATGTGTTTAGCTCAGCCCAACGACTAGACCCTGTCTATTTTGTGGCTCCTGCCAAATTTCTTGGGAATCAACAGGTGAGCTATGGTCAAAGCCTGTCCTTTGACTACCGTGTGGACAGAGGAGGCAGACACCCATCTGCCCATGATGTGATTCTGGAAGGTGCTGGTCTACGGATCACAGCTCCCTTGATGCCACTTGGCAAGACACTGCCTTGTGGGCTCACCAAGACTTACACATTCAGGTTAAATGAGCATCCAAGCAATAATTGGAGCCCCCAGCTGAGTTACTTTGAGTATCGAAGGTTACTGCGGAATCTCACAGCCCTCCGCATCCGAGCTACATATGGAGAATACAGTACTGGGTACATTGACAATGTGACCCTGATTTCAGCCCGCCCTGTCTCTGGAGCCCCAGCACCCTGGGTTGAACAGTGTATATGTCCTGTTGGGTACAAGGGGCAATTCTGCCAGGATTGTGCTTCTGGCTACAAGAGAGATTCAGCGAGACTGGGGCCTTTTGGCACCTGTATTCCTTGTAACTGTCAAGGGGGAGGGGCCTGTGATCCAGACACAGGAGATTGTTATTCAGGGGATGAGAATCCTGACATTGAGTGTGCTGACTGCCCAATTGGTTTCTACAACGATCCGCACGACCCCCGCAGCTGCAAGCCATGTCCCTGTCATAACGGGTTCAGCTGCTCAGTGATGCCGGAGACGGAGGAGGTGGTGTGCAATAACTGCCCTCCCGGGGTCACCGGTGCCCGCTGTGAGCTCTGTGCTGATGGCTACTTTGGGGACCCCTTTGGTGAACATGGCCCAGTGAGGCCTTGTCAGCCCTGTCAATGCAACAACAATGTGGACCCCAGTGCCTCTGGGAATTGTGACCGGCTGACAGGCAGGTGTTTGAAGTGTATCCACAACACAGCCGGCATCTACTGCGACCAGTGCAAAGCAGGCTACTTCGGGGACCCATTGGCTCCCAACCCAGCAGACAAGTGTCGAGCTTGCAACTGTAACCCCATGGGCTCAGAGCCTGTAGGATGTCGAAGTGATGGCACCTGTGTTTGCAAGCCAGGATTTGGTGGCCCCAACTGTGAGCATGGAGCATTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCAGCCAGTAACATGGAGCAACTGACAAGGGAAACTGAGGACTATTCCAAACAAGCCCTCTCACTGGTGCGCAAGGCCCTGCATGAAGGAGTCGGAAGCGGAAGCGGTAGCCCGGACGGTGCTGTGGTGCAAGGGCTTGTGGAAAAATTGGAGAAAACCAAGTCCCTGGCCCAGCAGTTGACAAGGGAGGCCACTCAAGCGGAAATTGAAGCAGATAGGTCTTATCAGCACAGTCTCCGCCTCCTGGATTCAGTGTCTCGGCTTCAGGGAGTCAGTGATCAGTCCTTTCAGGTGGAAGAAGCAAAGAGGATCAAACAAAAAGCGGATTCACTCTCAAGCCTGGTAACCAGGCATATGGATGAGTTCAAGCGTACACAGAAGAATCTGGGAAACTGGAAAGAAGAAGCACAGCAGCTCTTACAGAATGGAAAAAGTGGGAGAGAGAAATCAGATCAGCTGCTTTCCCGTGCCAATCTTGCTAAAAGCAGAGCACAAGAAGCACTGAGTATGGGCAATGCCACTTTTTATGAAGTTGAGAGCATCCTTAAAAACCTCAGAGAGTTTGACCTGCAGGTGGACAACAGAAAAGCAGAAGCTGAAGAAGCCATGAAGAGACTCTCCTACATCAGCCAGAAGGTTTCAGATGCCAGTGACAAGACCCAGCAAGCAGAAAGAGCCCTGGGGAGCGCTGCTGCTGATGCACAGAGGGCAAAGAATGGGGCCGGGGAGGCCCTGGAAATCTCCAGTGAGATTGAACAGGAGATTGGGAGTCTGAACTTGGAAGCCAATGTGACAGCAGATGGAGCCTTGGCCATGGAAAAGGGACTGGCCTCTCTGAAGAGTGAGATGAGGGAAGTGGAAGGAGAGCTGGAAAGGAAGGAGCTGGAGTTTGACACGAATATGGATGCAGTACAGATGGTGATTACAGAAGCCCAGAAGGTTGATACCAGAGCCAAGAACGCTGGGGTTACAATCCAAGACACACTCAACACATTAGACGGCCTCCTGCATCTGATGGGTATGTGA

Length: 3336

View AllClose

0 Reviews

View AllClose