Human LAGE3 cDNA Clone BC015744 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613513HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAGE3
Gene ID:
8270
Accession #:
BC015744
Plasmid:
pUC
€211.00
Frequently bought together:

Description

Human LAGE3 cDNA Clone BC015744 pUC Plasmid | Cusabio

Gene Name: LAGE3

Gene ID: 8270

Accession Number: BC015744

Vector: pUC

Sequence: ATGCGGGACGCGGATGCAGACGCAGGCGGAGGCGCTGACGGCGGGGATGGCCGGGGTGGCCACAGCTGCCGCGGGGGCGTGGACACAGCCGCAGCTCCGGCCGGTGGAGCTCCCCCAGCGCACGCGCCAGGTCCGGGCAGAGACGCCGCGTCTGCGGCCAGGGGGTCACGAATGCGGCCGCACATATTCACCCTCAGCGTGCCTTTCCCGACCCCCTTGGAGGCGGAAATCGCCCATGGGTCCCTGGCACCAGATGCCGAGCCCCACCAAAGGGTGGTTGGGAAGGATCTCACAGTGAGTGGCAGGATCCTGGTCGTCCGCTGGAAAGCTGAAGACTGTCGCCTGCTCCGAATTTCCGTCATCAACTTTCTTGACCAGCTTTCCCTGGTGGTGCGGACCATGCAGCGCTTTGGGCCCCCCGTTTCCCGCTAA

Length: 432

View AllClose

0 Reviews

View AllClose