Human LACTB2 cDNA Clone BC000878 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL706635HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LACTB2
Gene ID:
51110
Accession #:
BC000878
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LACTB2 cDNA Clone BC000878 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LACTB2

Gene ID: 51110

Accession Number: BC000878

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGCTGTACTGCAGCGCGTCGAGCGGCTGTCCAATCGAGTCGTGCGTGTGTTGGGCTGTAACCCGGGTCCCATGACCCTCCAAGGCACCAACACCTACCTAGTGGGGACCGGCCCCAGGAGAATCCTCATTGACACTGGAGAACCAGCAATTCCAGAATACATCAGCTGTTTAAAGCAGGCTCTAACTGAATTTAACACAGCAATCCAGGAAATTGTAGTGACTCACTGGCACCGAGATCATTCTGGAGGCATAGGAGATATTTGTAAAAGCATCAATAATGACACTACCTATTGCATTAAAAAACTCCCACGGAATCCTCAGAGAGAAGAAATTATAGGAAATGGAGAGCAACAATATGTTTATCTGAAAGATGGAGATGTGATTAAGACTGAGGGAGCCACTCTAAGAGTTCTATATACCCCTGGCCACACTGATGATCACATGGCTCTACTCTTAGAAGAGGAAAATGCTATCTTTTCTGGAGATTGCATCCTAGGGGAAGGAACAACGGTATTTGAAGACCTCTATGATTATATGAACTCTTTAAAAGAGTTATTGAAAATCAAAGCTGATATTATATATCCAGGACATGGCCCAGTAATTCATAATGCTGAAGCTAAAATTCAACAATACATTTCTCACAGAAATATTCGAGAGCAGCAAATTCTTACATTATTTCGTGAGAACTTTGAGAAATCATTTACAGTAATGGAGCTTGTAAAAATTATTTACAAGAATACTCCTGAGAATTTACATGAAATGGCTAAACATAATCTCTTACTTCATTTGAAAAAACTAGAAAAAGAAGGAAAAATATTTAGCAACACAGATCCTGACAAGAAATGGAAAGCTCATCTTTAG

Length: 867

View AllClose

0 Reviews

View AllClose