Human L3MBTL3 cDNA Clone BC060845 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL846646HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
L3MBTL3
Gene ID:
84456
Accession #:
BC060845
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human L3MBTL3 cDNA Clone BC060845 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: L3MBTL3

Gene ID: 84456

Accession Number: BC060845

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACTGAATCTGCCTCTAGCACAAGTGGTCAAGAGTTTGATGTGTTCAGTGTTATGGACTGGAAAGATGGAGTGGGCACGTTACCAGGAAGTGACTTAAAGTTTCGGGTAAATGAGTTTGGAGCCCTGGAAGTTATTACAGATGAGAATGAGATGGAAAATGTTAAAAAAGCAACTGCTACCACCACTTGGATGGTACCAACTGCTCAAGAAGTCTTTTCAGAGAAGACTGGGATGCCTTTCAGGTTGAAGGATCCAGTGAAAGTAGAAGGGCTTCAGTTCTGTGAGAACTGTTGTCAGTATGGCAACGTAGATGAGTGTCTTTCTGGAGGAAACTATTGCAGCCAGAATTGTGCTCGGCACATCAAAGATAAAGATCAGAAGGAAGAAAGGGACGTAGAAGAAGACAATGAGGAAGAAGATCCTAAGTGTAGTCGGAAGAAAAAACCAAAATTATCTCTGAAAGCTGACAACAAGGAGGATGGAGAAGAGAGAGATGATGAAATGGAGAACAAACAAGATGTAAGAATCCTGAGGGGTTCGCAGAGAGCACGGAGGAAAAGACGAGGGGATTCGGCTGTACTAAAGCAGGGTTTGCCTCCTAAAGGAAAGAAAGCGTGGTGCTGGGCATCCTACCTGGAAGAGGAGAAAGCGGTGGCAGTGCCGGCGAAGCTGTTCAAGGAGCATCAATCCTTTCCATATAACAAAAATGGATTCAAAGTTGGCATGAAATTAGAAGGCGTGGATCCCGAGCATCAGTCTGTGTACTGTGTCCTCACCGTCGCGGAGGTTTGTGGATACCGGATAAAGCTTCACTTTGATGGGTATTCTGATTGCTATGACTTCTGGGTGAATGCAGACGCTCTGGATATCCACCCAGTTGGGTGGTGTGAGAAAACCGGCCACAAACTCCATCCTCCAAAAGGGTATAAAGAAGAAGAATTCAATTGGCAGACCTATCTTAAGACATGTAAAGCTCAAGCTGCTCCTAAGTCATTATTTGAAAATCAGAATATAACAGTGATCCCATCGGGCTTTCGAGTTGGTATGAAGCTTGAGGCAGTAGACAAAAAGAATCCCTCATTCATCTGTGTTGCTACGGTAACAGATATGGTGGACAATCGTTTCCTGGTACATTTTGACAACTGGGATGAGAGCTATGACTATTGGTGTGAAGCATCAAGTCCACATATTCATCCAGTTGGTTGGTGTAAGGAACATAGAAGAACCCTTATTACTCCACCAGGTTATCCAAATGTGAAACATTTTTCTTGGGATAAATACTTAGAAGAAACCAATTCTTTACCTGCTCCTGCAAGAGCTTTCAAAGTGAAACCTCCTCATGGATTCCAGAAAAAAATGAAGCTTGAGGTTGTAGACAAAAGGAACCCTATGTTTATTAGAGTAGCAACTGTGGCAGACACAGATGATCACCGGGTAAAAGTTCACTTTGATGGCTGGAACAATTGCTATGATTACTGGATAGATGCAGATTCTCCTGATATTCACCCTGTAGGCTGGTGTTCAAAAACAGGACATCCCCTTCAGCCTCCTTTGAGCCCCTTAGAATTAATGGAAGCTTCAGAACATGGTGGATGCTCAACCCCGGGATGTAAAGGGATTGGCCATTTCAAGAGAGCGAGACATCTGGGCCCTCACAGTGCTGCCAACTGTCCCTATTCAGAAATCAATTTGAATAAAGACCGTATTTTTCCAGACCGCTTAAGTGGTGAGATGCCTCCGGCTAGTCCGTCATTTCCAAGAAATAAAAGGACAGATGCAAATGAAAGCTCTTCTTCCCCTGAAATCAGAGACCAGCATGCTGATGATGTCAAAGAAGACTTTGAAGAGAGAACAGAAAGTGAAATGAGAACATCACATGAAGCCAGAGGTGCCCGGGAAGAACCCACCGTCCAGCAGGCACAGCGTCGGTCAGCTGTCTTTCTGTCCTTTAAGTCCCCAATTCCATGTCTGCCCTTGCGCTGGGAGCAGCAAAGCAAACTTCTTCCAACTGTCGCAGGAATCCCTGCCAGTAAAGTTTCCAAATGGAGCACAGACGAGGTGTCAGAATTTATACAGAGCTTACCTGGGTGTGAAGAACATGGAAAGGTATTTAAAGATGAACAAATTGATGGAGAAGCATTTCTACTTATGACTCAAACAGACATTGTTAAAATTATGAGCATTAAACTGGGCCCTGCTCTCAAAATTTTCAATTCCATCCTGATGTTCAAAGCTGCAGAGAAGAATTCTCACAATGAACTTTGA

Length: 2268

View AllClose

0 Reviews

View AllClose