null

Human KCNIP2 cDNA Clone BC034685 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL889100HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
KCNIP2
Gene ID:
30819
Accession #:
BC034685
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human KCNIP2 cDNA Clone BC034685 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: KCNIP2

Gene ID: 30819

Accession Number: BC034685

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCGGGGCCAGGGCCGCAAGGAGAGTTTGTCCGATTCCCGAGACCTGGACGGCTCCTACGACCAGCTCACGGGCCACCCTCCAGGGCCCACTAAAAAAGCGCTGAAGCAGCGATTCCTCAAGCTGCTGCCGTGCTGCGGGCCCCAAGCCCTGCCCTCAGTCAGTGAAAACAGCGTGGACGATGAATTTGAATTGTCCACCGTGTGTCACCGGCCTGAGGGTCTGGAGCAGCTGCAGGAGCAAACCAAATTCACGCGCAAGGAGTTGCAGGTCCTGTACCGGGGCTTCAAGAACGAATGTCCCAGCGGAATTGTCAATGAGGAGAACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGCACCTATGCCACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAGGACTTTGTGGCTGGTTTGTCCGTGATTCTTCGGGGAACTGTAGATGACAGGCTTAATTGGGCCTTCAACCTGTATGACCTTAACAAGGACGGCTGCATCACCAAGGAGGAAATGCTTGACATCATGAAGTCCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAGGCCCCAAGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAAAAGGATGAGAACATCATGAGGTCCATGCAGCTCTTTGACAATGTCATCTAG

Length: 759

View AllClose

0 Reviews

View AllClose