Cusabio Customized Plasmid
Human INPP4B cDNA Clone BC005273 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL011732HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- INPP4B
- Gene ID:
- 8821
- Accession #:
- BC005273
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human INPP4B cDNA Clone BC005273 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: INPP4B
Gene ID: 8821
Accession Number: BC005273
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGAAATTAAAGAGGAAGGGGCATCAGAAGAAGGGCAGCACTTTCTTCCTACAGCCCAGGCCAATGATCCCGGGGACTGTCAGTTCACAAGTATCCAGAAGACTCCAAATGAACCGCAGTTGGAATTCATCCTTGATTTGAATCAAGAATTAAGAGATTAG
Length: 162
Related Products
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC41Gene ID: 10489Accession Number: BC004953Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL614889HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC41
- Gene ID:
- 10489
- Accession #:
- BC004953
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid | CusabioGene Name: LMO3Gene ID: 55885Accession Number: BC026311Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL844705HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LMO3
- Gene ID:
- 55885
- Accession #:
- BC026311
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRIQ1Gene ID: 84125Accession Number: BC005399Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL842693HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRIQ1
- Gene ID:
- 84125
- Accession #:
- BC005399
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC48Gene ID: 83450Accession Number: BC050419Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL887941HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC48
- Gene ID:
- 83450
- Accession #:
- BC050419
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC40Gene ID: 55631Accession Number: BC008586Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL881002HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC40
- Gene ID:
- 55631
- Accession #:
- BC008586
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC