null

Human IFT52 cDNA Clone BC039831 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL896883HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IFT52
Gene ID:
51098
Accession #:
BC039831
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human IFT52 cDNA Clone BC039831 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: IFT52

Gene ID: 51098

Accession Number: BC039831

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGAAAGAGCTGCGGAGCACCATTCTTTTCAATGCCTACAAAAAGGAGATATTTACCACCAACAATGGCTACAAATCCATGCAGAAAAAACTTCGGAGTAATTGGAAGATTCAGAGCTTAAAAGATGAAATCACATCTGAGAAGTTAAATGGAGTAAAACTGTGGATTACAGCTGGGCCAAGGGAAAAATTTACTGCAGCTGAGTTTGAAATCCTGAAGAAATATCTTGACACTGGTGGAGATGTCTTTGTGATGCTAGGAGAAGGTGGAGAATCCAGATTTGACACCAATATTAACTTTTTACTAGAAGAATATGGAATCATGGTTAATAATGATGCTGTGGTTAGAAATGTATATCACAAATATTTCCATCCTAAAGAAGCTCTAGTTTCCAGTGGAGTCTTGAACAGGGAAATTAGCCGAGCTGCAGGAAAGGCTGTGCCTGGGATCATTGATGAGGAAAGCAGTGGAAACAATGCCCAGGCTCTCACCTTTGTGTATCCTTTTGGTGCCACATTGAGTGTCATGAAACCAGCAGTGGCGGTTCTGTCTACAGGTTCTGTCTGCTTCCCACTTAACAGACCCATTTTGGCTTTCTATCACTCAAAGAACCAAGGTGGGAAGCTGGCAGTGCTTGGTTCATGTCACATGTTCAGTGATCAATATTTGGACAAAGAAGAAAACAGCAAAATCATGGATGTTGTTTTCCAGTGGCTCACGACAGGAGACATCCACCTAAACCAGATTGATGCTGAGGACCCAGAGATTTCTGACTACATGATGCTGCCCTACACAGCCACCCTATCAAAGCGGAATCGAGAGTGTCTCCAGGAGAGTGATGAGATCCCAAGGGACTTTACCACCCTCTTCGACCTGTCCATCTTCCAGCTGGATACCACCTCCTTCCACAGCGTCATCGAGGCTCACGAGCAGCTAAATGTGAAACATGAACCACTCCAGCTCATCCAGCCTCAGTTTGAGACGCCGCTGCCAACCCTTCAGCCTGCGGTTTTTCCTCCCAGTTTCCGGGAGTTACCACCTCCTCCTCTGGAGCTATTTGATTTAGATGAAACGTTCTCCTCTGAGAAGGCACGGCTGGCTCAGATTACCAATAAGTGTACTGAAGAAGACCTGGAATTTTATGTCAGGAAGTGTGGTGATATTCTTGGAGTAACCAGTAAACTACCAAAGGACCAACAGGATGCCAAACATATCCTTGAGCACGTCTTCTTCCAAGTGGTGGAGTTCAAGAAATTGAACCAGGAACATGACATCGATACAAGTGAAACAGCATTCCAGAACAATTTCTGA

Length: 1314

View AllClose

0 Reviews

View AllClose