null

Human FAM72A cDNA Clone BC035696 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL713147HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM72A
Gene ID:
729533
Accession #:
BC035696
Plasmid:
pUC
€217.00
Frequently bought together:

Description

Human FAM72A cDNA Clone BC035696 pUC Plasmid | Cusabio

Gene Name: FAM72A

Gene ID: 729533

Accession Number: BC035696

Vector: pUC

Sequence: ATGTCTACCAACATTTGTAGTTTCAAGGACAGGTGCGTGTCCATCCTGTGTTGCAAATTCTGTAAACAAGTGCTCAGCTCTAGGGGAATGAAGGCTGTTTTGCTGGCTGATACTGAAATAGACCTTTTCTCTACAGACATCCCTCCTACCAACGCAGTGGACTTCACTGGAAGATGCTATTTCACCAAAATCTGCAAATGTAAACTGAAGGACATCGCATGTTTAAAATGTGGGAACATTGTAGGTTATCATGTGATTGTTCCATGTAGTTCCTGTCTTCTTTCCTGCAACAACGGACACTTCTGGATGTTTCACAGCCAGGCAGTTTATGATATTAACAGACTAGACTCCACAGGTGTAAACGTCCTACTTTGGGGCAACTTGCCAGAGATAGAAGAGAGTACAGATGAAGATGTGTTAAATATCTCAGCAGAGGAGTGTATTAGATAA

Length: 450

View AllClose

0 Reviews

View AllClose