null

Human FAM113B cDNA Clone BC016154 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822224HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM113B
Gene ID:
91523
Accession #:
BC016154
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human FAM113B cDNA Clone BC016154 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FAM113B

Gene ID: 91523

Accession Number: BC016154

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATTCCTGCCTCTGGGACATCTCCAGGTATGGTCCGAACTCCTGGAGAAGCTACCTGGAGAACCTGGAGAACCTGTTCCAGTGCCTGGGCCAGGTGCTGCCCGAGTCTTGCCTCCTGGTGTGGAACACGGCCATGCCTGTGGGCGAGGAAGTCACCGGGGGTTTTCTTCCGCCCAAGCTCCGGCGGCAGAAGGCCACCTTCCTGAAAAACGAAGTGGTCAAAGCCAACTTCCACAGCGCCACCGAGGCACGTAAACATAACTTCGATGTACTGGACTTGCATTTCCACTTCCGCCACGCGAGGGAGAACCTGCACTGGGACGGGGTGCACTGGAATGGACGTGTGCACCGCTGCCTCTCCCAGCTGCTGCTGGCCCACGTGGCCGACGCCTGGGGTGTGGAGCTGCCCCACCGCCACCCCGTGGGCGAGTGGATCAAGAAGAAAAAACCTGGCCCGAGAGTCGAAGGGCCGCCCCAGGCCAACAGAAATCACCCGGCCTTACCTCTGTCCCCACCCTTACCTTCCCCCACATACCGCCCCCTGCTTGGGTTCCCACCCCAGCGCTTACTTTCCAGTCGGATCAATTCTATTGCCATTCAGATGTCCCCTCATCAGCCCATGCAGGTTTCTTCGTCGAAGACAATTTTATGGTTGGTCCTCAGCTGCCTATGCCCTTCTTCCCCACACCCCGTTATCAGCGGCCTGCCCCAGTGGTACATAGGGGTTTTGGCAGGTATCGTCCCCGTGGCCCCTATACGCCCTGGGGACAGCGGCCTCGACCTTCAAAGAGAAGGGCCCCAGCCAATCCTGAGCCAAGGCCTCAATAGACGGACCTAG

Length: 840

View AllClose

0 Reviews

View AllClose