null

Human FA2H cDNA Clone BC002679 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007937HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FA2H
Gene ID:
79152
Accession #:
BC002679
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human FA2H cDNA Clone BC002679 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FA2H

Gene ID: 79152

Accession Number: BC002679

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGAACGAGCCTGTAGCCCTTGAGGAAACTCAGAAGACAGATCCTGCTATGGAACCACGGTTCAAAGTGGTGGATTGGGACAAGGACCTGGTGGACTGGCGAAAGCCTCTCCTGTGGCAGGTGGGCCACTTGGGAGAGAAGTACGATGAGTGGGTTCACCAGCCGGTGACCAGGCCCATCCGCCTCTTCCACTCAGACCTCATTGAGGGCCTCTCTAAGACTGTCTGGTACAGTGTCCCCATCATCTGGGTGCCCCTGGTGCTGTATCTCAGCTGGTCCTACTACCGAACCTTTGCCCAGGGCAACGTCCGACTCTTCACGTCATTTACAACAGAGTACACGGTGGCAGTGCCCAAGTCCATGTTCCCCGGGCTCTTCATGCTGGGGACATTCCTCTGGAGCCTCATCGAGTACCTCATCCACCGCTTCCTGTTCCACATGAAGCCCCCCAGCGACAGCTATTACCTCATCATGCTGCACTTCGTCATGCACGGCCAGCACCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCCCCTGTGCCAGCCTCCCTGGTGATCGGCGTCTTCTACTTGTGCATGCAGCTCATCCTGCCTGAGGCAGTAGGGGGCACTGTGTTTGCGGGGGGCCTCCTGGGCTACGTCCTCTATGACATGACCCATTACTACCTGCACTTTGGCTCGCCGCACAAGGGCTCCTACCTGTACAGCCTGAAGGCCCACCACGTCAAGCACCACTTTGCACATCAGAAGTCAGGATTTGGTATCAGCACTAAATTGTGGGATTACTGTTTCCACACCCTCACTCCAGAGAAACCCCACCTGAAGACGCAGTGA

Length: 843

View AllClose

0 Reviews

View AllClose