Human EIF1AD cDNA Clone BC005131 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL850842HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EIF1AD
Gene ID:
84285
Accession #:
BC005131
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EIF1AD cDNA Clone BC005131 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EIF1AD

Gene ID: 84285

Accession Number: BC005131

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTCAGGCCACCAAGAGGAAGCATGTGGTGAAGGAGGTGCTAGGGGAGCACATAGTGCCCTCCAACCAGCAGCAGATTGTCAGGGTACTCAGGACCCCAGGGAACAATCTGCATGAGGTGGAGACAGCCCAAGGGCAGCGCTTCCTGGTGAGCATGCCCTCCAAATACCGCAAGAACATCTGGATCAAGAGAGGGGACTTTCTCATTGTTGACCCCATTGAAGAGGGAGAAAAGGTGAAGGCTGAAATCTCGTTTGTGCTCTGCAAGGACCACGTGCGCTCTCTGCAGAAGGAGGGGTTTTGGCCTGAGGCCTTCTCTGAAGTGGCTGAGAAACACAACAACAGGAACAGACAAACTCAACCAGAACTCCCAGCTGAGCCACAGTTATCAGGAGAGGAGTCCAGCTCAGAAGATGATTCTGACCTGTTTGTTAACACAAACCGCAGACAGTATCATGAGAGTGAGGAGGAGAGTGAAGAGGAGGAGGCAGCCTGA

Length: 498

View AllClose

0 Reviews

View AllClose