Human EHBP1 cDNA Clone BC029477 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL836723HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EHBP1
Gene ID:
23301
Accession #:
BC029477
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EHBP1 cDNA Clone BC029477 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EHBP1

Gene ID: 23301

Accession Number: BC029477

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTTCAGTTTGGAAGAGACTGCAGCGTGTGGGAAAACATGCATCCAAGTTCCAGTTTGTGGCCTCCTACCAGGAGCTCATGGTTGAGTGTACGAAGAAATGGCAACCAGATAAACTGGTGGTAGTTTGGACCAGAAGAAGCCGAAGGAAGTCTTCTAAGGCACATAGCTGGCAACCTGGAATAAAAAATCCCTATCGTGGTGTTGTTGTGTGGCCTGTTCCTGAAAACATTGAAATCACTGTAACACTTTTTAAGGATCCTCATGCGGAAGAATTTGAAGACAAAGAGTGGACATTTGTCATAGAAAATGTAAGCTAA

Length: 321

View AllClose

0 Reviews

View AllClose