Human EGLN2 cDNA Clone BC001723 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL856968HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGLN2
Gene ID:
112398
Accession #:
BC001723
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EGLN2 cDNA Clone BC001723 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EGLN2

Gene ID: 112398

Accession Number: BC001723

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAG

Length: 378

View AllClose

0 Reviews

View AllClose