Human EGFLAM cDNA Clone BC063822 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL723649HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGFLAM
Gene ID:
133584
Accession #:
BC063822
Plasmid:
pUC
€1,037.00
Frequently bought together:

Description

Human EGFLAM cDNA Clone BC063822 pUC Plasmid | Cusabio

Gene Name: EGFLAM

Gene ID: 133584

Accession Number: BC063822

Vector: pUC

Sequence: ATGGATTTAATCCGAGGCGTCTTGCTCCGGCTCCTGCTCCTGGCTTCCAGCCTCGGACCCGGCGCGGTGTCGCTCCGAGCGGCCATCCGAAAACCAGGCAAGGTAGGGCCTCCTCTTGACATCAAGCTGGGCGCATTGAACTGTACGGCTTTCAGCATCCAGTGGAAAATGCCAAGGCATCCTGGAAGTCCCATCCTTGGGTACACTGTCTTTTACTCTGAGGTTGGCGCAGATAAATCCCTGCAGGAGCAGTTGCACAGCGTGCCTCTCAGCCGGGACATCCCGACCACGGAGGAAGTGATTGGAGATTTGAAACCAGGCACTGAATATCGTGTGAGCATAGCAGCTTACAGCCAGGCTGGCAAAGGGCGGCTGAGCTCTCCTCGGCATGTCACCACTTTGTCCCAAGATTCCTGCCTGCCTCCTGCAGCTCCCCAGCAGCCACATGTCATTGTGGTTTCGGATTCTGAGGTGGCCCTGTCTTGGAAACCTGGAGCGAGTGAAGGAAGCGCCCCTATTCAGTACTATTCTGTGGAATTCATCAGGCCAGATTTCGACAAGAAGTGGACCTCAATCCATGAGCGGATCCAGATGGACTCCATGGTTATCAAGGGCCTCGATCCAGATACCAACTACCAGTTTGCCGTGAGGGCAATGAATTCCCATGGCCCCAGCCCCCGCAGCTGGCCCAGTGACATCATCCGGACCCTCTGCCCTGAGGAGGCGGGAAGTGGCCGCTATGGACCCCGTTATATCACCGACATGGGAGCTGGTGAGGATGATGAAGGATTTGAAGACGACTTAGATTTGGATATTTCCTTTGAGGAGGTTAAACCACTTCCTGCTACCAAAGGAGGGAATAAGAAATTTTTGGTGGAAAGCAAGAAGATGTCTATATCTAACCCAAAGACCATTTCTAGGCTCATCCCCCCTACCTCAGCATCTCTCCCTGTGACCACGGTGGCTCCCCAGCCCATTCCCATACAGAGAAAGGGGAAGAATGGTGTGGCCATAATGTCAAGGCTCTTTGACATGCCTTGTGATGAAACTCTCTGCTCTGCTGACAGCTTCTGTGTCAATGACTACACCTGGGGGGGCTCGCGATGCCAGTGCACCCTGGGCAAAGGTGGTGAGAGCTGCTCAGAAGATATTGTTATCCAGTATCCTCAGTTCTTTGGCCACTCCTATGTAACGTTTGAACCTCTGAAGAATTCTTATCAGGCATTTCAAATTACTCTTGAATTTAGGGCGGAGGCAGAGGATGGCTTACTGCTCTACTGTGGGGAGAACGAACACGGGAGGGGGGATTTCATGTCCCTGGCTATCATCCGACGCTCCCTGCAGTTCAGGTTTAATTGTGGAACTGGGGTTGCCATCATCGTAAGTGAGACCAAAATCAAACTAGGGGGTTGGCACATGGTTATGCTCTACAGAGATGGGCTGAACGGGCTGCTGCAGCTGAACAATGGCACCCCAGTGACAGGCCAGTCTCAGGGCCAATACAGTAAAATTACTTTCCGGACACCTCTCTATCTTGGTGGCGCTCCCAGCGCTTACTGGTTGGTTAGAGCAACAGGGACAAACCGAGGCTTTCAAGGCTGTGTGCAGTCGCTCGCTGTGAATGGGAGGAGAATTGACATGAGGCCCTGGCCCCTGGGAAAAGCACTCAGTGGGGCTGATGTGGGGGAATGCAGCAGTGGAATCTGTGATGAGGCCTCGTGCATCCATGGTGGCACCTGCACAGCAATCAAAGCCGACTCCTACATTTGCCTCTGTCCCCTTGGGTTTAAAGGTCGACACTGTGAAGATGCTTTCACCTTGACCATTCCTCAGTTCAGAGAGTCTCTGAGATCTTACGCTGCAACTCCCTGGCCACTGGAGCCCCAGCATTACCTTTCCTTCATGGAATTTGAGATCACATTTCGGCCAGACTCAGGAGATGGTGTCCTCCTGTACAGCTATGACACAGGCAGCAAAGACTTCCTGTCCATCAACTTGGCAGGGGGCCACGTGGAGTTCCGCTTTGACTGTGGCTCTGGGACCGGTGTCCTCAGGAGTGAAGATCCCCTCACCCTGGGCAACTGGCACGAGCTTCGTGTATCTCGCACAGCAAAGAATGGAATCTTACAGGTGGATAAGCAGAAGATAGTGGAGGGAATGGCAGAGGGAGGCTTCACACAGATTAAGTGCAACACAGACATTTTCATTGGCGGAGTCCCCAATTATGATGATGTGAAGAAGAACTCGGGTGTCCTGAAGCCTTTCAGCGGGAGCATCCAGAAGATCATCCTGAATGACCGAACCATCCATGTGAAGCATGACTTCACCTCCGGAGTGAATGTGGAGAATGCGGCCCACCCCTGTGTGAGAGCCCCTTGTGCCCATGGGGGCAGCTGCCGGCCCAGGAAGGAGGGCTATGACTGTGACTGCCCCTTGGGCTTTGAGGGGCTTCACTGCCAGAAAGCGATCATAGAAGCCATTGAGATCCCGCAGTTTATCGGCCGCAGTTACCTGACGTATGACAACCCAGATATCTTGAAGAGGGTGTCAGGATCAAGATCAAATGTGTTCATGAGGTTTAAAACAACTGCCAAGGATGGCCTTTTGCTGTGGAGGGGAGACAGCCCCATGAGACCCAACAGCGACTTCATTTCCTTGGGCCTTCGGGATGGAGCCCTCGTGTTCAGCTATAACCTGGGCAGTGGTGTGGCATCCATCATGGTGAATGGCTCCTTCAACGATGGTCGGTGGCACCGAGTTAAGGCCGTTAGGGATGGCCAGTCAGGAAAGATAACCGTGGATGACTATGGAGCCAGAACAGGCAAATCCCCAGGCATGATGCGGCAGCTTAACATCAATGGAGCTCTGTATGTGGGTGGAATGAAGGAAATTGCTCTGCACACTAACAGGCAATATATGAGAGGGCTCGTGGGCTGTATCTCTCACTTCACCCTGTCCACCGATTACCACATTTCCCTCGTGGAAGATGCCGTGGATGGAAAAAACATCAACACTTGTGGAGCCAAGTAA

Length: 3030

View AllClose

0 Reviews

View AllClose