Human EFTUD1 cDNA Clone BC014628 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL772011HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFTUD1
Gene ID:
79631
Accession #:
BC014628
Plasmid:
pUC
€777.00
Frequently bought together:

Description

Human EFTUD1 cDNA Clone BC014628 pUC Plasmid | Cusabio

Gene Name: EFTUD1

Gene ID: 79631

Accession Number: BC014628

Vector: pUC

Sequence: ATGGTGCTCAACAGTTTGGATAAGATGATTCAACTCCAGAAAAACACTGCCAACATCAGGAATATTTGTGTTTTGGCTCATGTTGACCATGGAAAAACTACTCTGGCTGACTGTCTTATATCTAGCAATGGAATCATCTCCAGCCGCCTAGCAGGCAAGTTAAGGTACATGGACAGCAGAGAAGATGAACAGATCCGAGGGATCACTATGAAATCCAGTGCCATTTCCCTACATTATGCAACAGGTAATGAGGAGTACCTGATCAATCTGATAGACTCTCCAGGACACGTGGACTTTTCCTCAGAAGTATCAACCGCTGTTCGCATTTGTGATGGATGCATCATTGTGGTAGATGCTGTGGAAGGAGTCTGTCCACAGACACAGGCAGTTCTGCGACAAGCTTGGCTTGAAAACATCCGTCCGGTTTTAGTGATTAATAAGATTGATCGCTTGATAGTGGAACTGAAATTCACCCCACAAGAGGCCTATTCTCACCTCAAGAATATTTTAGAACAGATTAATGCGCTCACAGGGACTCTTTTTACTTCTAAAGTCCTAGAAGAAAGAGCAGAGAGGGAGACTGAATCCCAAGTGAATCCAAATTCTGAACAAGGAGAGCAAGTATATGACTGGAGCACTGGCTTGGAGGACACAGATGATTCTCACCTTTACTTCTCTCCAGAACAGGGAAATGTGGTGTTTACCAGTGCAATAGATGGGTGGGGCTTTGGAATTGAGCACTTCGCCAGAATCTACAGTCAAAAAATTGGCATCAAAAAGGAAGTTCTTATGAAAACCTTGTGGGGAGATTACTATATAAATATGAAGGCTAAAAAGATCATGAAGGGTGATCAGGCCAAAGGAAAGAAACCTTTATTTGTACAGTTGATCCTGGAAAATATATGGAGTTTGTATGATGCTGTTTTGAAAAAGGACAAAGACAAAATTGATAAAATAGTGACTTCTTTAGGATTAAAAATTGGAGCCCGGGAGGCACGACATTCAGACCCTAAAGTTCAGATCAACGCCATTTGCAGTCAGTGGCTACCCATATCCCATGCTGTTCTTGCTATGGTGTGTCAGAAACTTCCTAGTCCCCTTGATATTACAGCTGAGAGAGTGGAGAGACTGATGTGCACAGGATCACAAACTTTTGACTCTTTTCCACCAGAAACTCAAGCACTGAAAGCAGCTTTTATGAAATGTGGAAGTGAGGACACTGCTCCAGTTATTATATTTGTTTCCAAAATGTTTGCAGTTGATGCTAAGGCCTTGCCTCAGAATAAGCCAAGGCCTCTCACTCAAGAAGAAATTGCTCAGAGACGTGAGCGTGCAAGACAAAGGCATGCAGAGAAGCTTGCAGCAGCACAGGGACAGGCACCCTTGGAGCCCACCCAAGATGGGAGTGCCATTGAAACATGTCCAAAAGGAGACGAGCCAAGAGGTGACGAGCAACAGGTGGAAAGTATGACCCCTAAACCTGTGCTCCAGGAAGAAAACAACCAAGAGTCTTTTATTGCATTTGCTCGGGTGTTCAGTGGTGTGGCTCGAAGAGGAAAGAAAATTTTTGTCTTGGGGCCCAAATACAGTCCTCTTGAGTTTTTACGAAGGGTACCATTAGGCTTCTCAGCTCCACCAGATGGCCTCCCCCAAGTCCCCCACATGGCATACTGTGCTCTGGAAAACCTGTATCTTCTGATGGGAAGGGAACTGGAATATCTAGAGGAGGTACCTCCAGGAAATGTGCTAGGAATAGGAGGCCTTCAAGATTTTGTGCTGAAATCTGCAACACTGTGTAGCCTGCCATCCTGCCCACCATTTATACCACTCAACTTCGAAGCCACTCCTATTGTGAGAGTTGCTGTTGAACCAAAACATCCAAGTGAAATGCCTCAGCTCGTAAAAGGAATGAAACTGTTAAACCAGGCTGATCCCTGTGTCCAGATTTTAATTCAGGAAACGGGAGAGCACGTTTTAGTCACAGCAGGAGAAGTCCACCTTCAGCGATGCCTGGATGACTTAAAAGAAAGGTTTGCAAAGATTCATATCAGTGTATCTGAACCTATTATTCCATTCAGAGAAACAATCACAAAACCCCCAAAAGTTGACATGGTCAATGAAGAAATAGGCAAACAGCAAAAAGTTGCAGTCATACACCAAATGAAAGAAGATCAAAGCAAAATCCCTGAAGGAATCCAAGTTGACTCTGACGGGCTAATCACCATAACAACTCCCAATAAACTTGCCACGCTCAGTGTTCGAGCCATGCCCCTTCCAGAAGAAGTCACCCAGATTCTGGAAGAAAATAGTGATTTGATTCGTTCTATGGAGCAGTTGACATCCTCTTTGAATGAGGGCGAAAATACTCACATGATTCATCAGAAGACCCAAGAGAAAATTTGGGAATTCAAAGGAAAACTGGAGCAACACCTAACCGGGAGAAGATGGAGGAACATTGTTGACCAAATCTGGTCATTTGGCCCAAGAAAATGTGGGCCCAACATACTAGTCAATAAAAGTGAAGATTTTCAGAACTCAGTATGGACAGGTCCAGCTGACAAAGCTTCAAAAGAAGCCAGTAGATACCGAGATTTGGGTCTATAG

Length: 2604

View AllClose

0 Reviews

View AllClose