Human EFNB2 cDNA Clone BC069342 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007466HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFNB2
Gene ID:
1948
Accession #:
BC069342
Plasmid:
pUC
€360.00
Frequently bought together:

Description

Human EFNB2 cDNA Clone BC069342 pUC Plasmid | Cusabio

Gene Name: EFNB2

Gene ID: 1948

Accession Number: BC069342

Vector: pUC

Sequence: ATGGCTGTGAGAAGGGACTCCGTGTGGAAGTACTGCTGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGGATCAACCAGGAATAAAGATCCAACAAGACGTCCAGAACTAGAAGCTGGTACAAATGGAAGAAGTTCGACAACAAGTCCCTTTGTAAAACCAAATCCAGGTTCTAGCACAGACGGCAACAGCGCCGGACATTCGGGGAACAACATCCTCGGTTCCGAAGTGGCCTTATTTGCAGGGATTGCTTCAGGATGCATCATCTTCATCGTCATCATCATCACGCTGGTGGTCCTCTTGCTGAAGTACCGGAGGAGACACAGGAAGCACTCGCCGCAGCACACGACCACGCTGTCGCTCAGCACACTGGCCACACCCAAGCGCAGCGGCAACAACAACGGCTCAGAGCCCAGTGACATTATCATCCCGCTAAGGACTGCGGACAGCGTCTTCTGCCCTCACTACGAGAAGGTCAGCGGGGACTACGGGCACCCGGTGTACATCGTCCAGGAGATGCCCCCGCAGAGCCCGGCGAACATTTACTACAAGGTCTGA

Length: 1002

View AllClose

0 Reviews

View AllClose