Human EFNA4 cDNA Clone BC107483 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007463HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFNA4
Gene ID:
1945
Accession #:
BC107483
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EFNA4 cDNA Clone BC107483 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFNA4

Gene ID: 1945

Accession Number: BC107483

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCGGCTGCTGCCCCTGCTGCGGACTGTCCTCTGGGCCGCGTTCCTCGGCTCCCCTCTGCGCGGGGGCTCCAGCCTCCGCCACGTAGTCTACTGGAACTCCAGTAACCCCAGGTTGCTTCGAGGAGACGCCGTGGTGGAGCTGGGCCTCAACGATTACCTAGACATTGTCTGCCCCCACTACGAAGGCCCAGGGCCCCCTGAGGGCCCCGAGACGTTTGCTTTGTACATGGTGGACTGGCCAGGCTATGAGTCCTGCCAGGCAGAGGGCCCCCGGGCCTACAAGCGCTGGGTGTGCTCCCTGCCCTTTGGCCATGTTCAATTCTCAGAGAAGATTCAGCGCTTCACACCCTTCTCCCTCGGCTTTGAGTTCTTACCTGGAGAGACTTACTACTACATCTCGGTGCCCACTCCAGAGAGTTCTGGCCAGTGCTTGAGGCTCCAGGTGTCTGTCTGCTGCAAGGAGAGGAAGTCTGAGTCAGCCCATCCTGTTGGGAGCCCTGGAGAGAGTGGCACATCAGGGTGGCGAGGGGGGGACACTCCCAGCCCCCTCTGTCTCTTGCTATTACTGCTGCTTCTGATTCTTCGTCTTCTGCGAATTCTGTGA

Length: 606

View AllClose

0 Reviews

View AllClose