Human EFHC2 cDNA Clone BC031039 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL705512HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFHC2
Gene ID:
80258
Accession #:
BC031039
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human EFHC2 cDNA Clone BC031039 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFHC2

Gene ID: 80258

Accession Number: BC031039

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCCTGCCTCTGCTGCCGGGCAACAGCTTCAACCGCAACGTGGGAAAGGAGAAGTTTCACAAATCCCAACATTGGGGCTTTTGCAACAATGTTATGATGTTGGTGAGTGATGAAAAGCCTGGAATAGGTGGAGAACCACTTCTGGGGCAAAAGATAAAGCCTAAATGTAGCATATATCCTAAAGGAGATGGAAGTGATGTACCATCATGGGTAGCCTTTGATAAACAGGTATTATCTTTTGATGCCTATTTGGAAGAGGAAGTACTTGATAAAAGCCAAACCAACTACAGAATAAGATACTATAAAATCTACTTCTACCCTGAAGATGACACAATTCAAGTAAATGAACCAGAGGTGAAAAATAGTGGATTACTTCAAGGGACTTCTATCCGGCGTCATCGGATTACTCTTCCGCCTCCTGATGAGGATCAGTTTTATACTGTGTATCATTTTAATGTCGGCACAGAGGTTGTCTTCTATGGCCGGACATTCAAGATTTATGACTGTGATGCATTCACAAGAAACTTTTTGAGGAAAATAGGGGTCAAAGTGAATCCCCCAGTGCAATGTCCAGAAGATCCTTACATGAAGATTCGGAGAGAGGTTGTAGAACACGTAGAGCCCTTACGTCCCTACGAATCCCTCGACACCCTGAAACAGTTCCTCCAGTATCATGGCAAGATTTTGTGTTTCTTCTGCCTGTGGGATGACTCAGTCTCAATGTTTGGAGACCGTAGAGAACTCATCCTGCATTACTTCTTGTGTGATGATACTATTGAAATCAAAGAATTGCTTCCACACAGCTCAGGCCGAGATGCTCTAAAAATGTTCCTCCGGAGGAGTAAGCTACCCAAGAATTGCCCACCTAGAGTCTATCAACCAGGCCAGATAACAGATCGAGCAGTTCTCAATTCATATGGTGACTTTATAAAGAACCAAGCGGATGGCTACCTGTTCGATAGATATAAGCTAGGAAAAGTAGACCAAGAGTTTTACAAAGATAGTGACCTGTCCCTAGGAGTCACCATCAATGTGTGGGGAAGAAAAGTGCTCCTTTATGACTGTGATGAATTTACGAAGTCTTATTATAAGTCTAAATATGGAATTGAGAACTTTACCTCAGTTTCATGCAAGCCTCCTTCTCCTCCTCCAAAAATAGAAAGGAAATTTCCACCTTACAACGGTTTTGGTTCTGAAGAGGATTCTCTCCGTAACTGCATAGACCTCAAGCCCACACCTCATCGGAGGAACTTCAAGAAGTTTATGGAAAAAGACAGCTATGGCTCCAAAAGCAATATACTCCGTTTTTTTGCAAAACTAGTCACAGACAAATGTGTTGACTTGGACAGGATGTTTGTTATTTCATATTATCTCGGTGATGACACCATTTCAGTGTTTGAACCTATAGAGAGGAATTCAGGAATTGCTGGTGGGATGTTCTTGAAAAGAAGTCGCGTTAAGAAGCCTGGACAAGAAGTCTTTAAAAGTGAACTATCTGAATATATCAAGGCCGAGGAGCTGTACATTGGAGTCACGGTGAATGTGAATGGTTACCTATTTCGTTTGCTCAATGCTGATGAGTATACCTTAAACTACATGGAGCAGAATACAGATAAGTATCCTTTCAGTAACCTCAAACTTGCCCTACAAAAGCTGAAGCAAGAAGAAGGAAAATCCAGAGAGCTCAAGCAGGTATTTAAAGCTGCTGACTCTAAGCACACAAATATGGTGGATTATAATACATTCAGAGACATATTGATGTCTTTGACTGTTGGAAACCTTGCAGAGCAAGAATTTGTAACCATTGCACGTCACTACCGTGTGCCTGAGGGCACATGTTCAGATATGGATTTCTTAATCGCACTGGCCCACGAAAAGTTCAAGAAAAATATGTTTGAGAATTTCGACACTTTCATTTATTCCTGTGTGTATGAAGATCGAGAAAAAAAAAATGTATTACCCACCAAAGACATTAAAAGGCTGTGCAAATCCTCCAGATTACCTTTGAGTGATGATCTTCTAGAATCCTTATTGTCAAGGTTTGAAGACAGTGAAAAACAAATAGATTATAAGTCATTTTTCTCTGCCCTGAACTGGAGAAAGAATCCAGTGCCTGAATTGCAACCAGCATCATACCTTAAAGAGAGATGTGAAGATGTTTGGCTTGGTATGCCATCACCTATTCCTGCGAAATACATTGACTACTGGACCTTTTTGAAGGACGCGTTTGGCTTAGAGGAGGAATAA

Length: 2250

View AllClose

0 Reviews

View AllClose