Human EFCAB7 cDNA Clone BC015814 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007447HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFCAB7
Gene ID:
84455
Accession #:
BC015814
Plasmid:
pUC
€591.00
Frequently bought together:

Description

Human EFCAB7 cDNA Clone BC015814 pUC Plasmid | Cusabio

Gene Name: EFCAB7

Gene ID: 84455

Accession Number: BC015814

Vector: pUC

Sequence: ATGGCGATCAGTCCACGAAGCGATGCAACTTTCTCCAGTCAGAAATCAACACCTTCAGAGAGTCCTCGAACAAAGAAATTTCCACTAACTGAAGAGGAAATATTTTATATGAATTGTAGAGCTGCCTACTTAACTGTCTTCAAAAGCAGCTTGGAAAACATTATTTCTAAAGATCAACTTTACTTAGCTCTTCAGCATGCAGGAAGAAATCCATCCCAAAAGACCATTAATAAGTATTGGACTCCTCAAACTGCCAAACTGAATTTTGATGATTTTTGTATAATTTTAAGGAAGGAAAAACCTACTTCAAAAGCAGAACTACTAAAATCTTTTAAGCAATTAGATGTAAATGATGATGGCTGTATTTTACACACTGACCTTTATAAATTTCTAACAAAGAGAGGTGAGAAGATGACTCGAGAAGAAGTAAATGCCATAATAAATTTGGCTGATGTAAATGCTGATGGCAAATTTGACTACATCAAGTTTTGTAAATTATATATGACAACCAACGAGCAATGTCTCAAGACTACACTAGAAAAACTAGAGGTTGACAGTAAATTGATGCGTCACCAGTTTGGAAACCACATCGAAGGGTCCCCTGAAAGGGACCCATCACCAGTACCAAAACCATCACCTAAAATCACAAGAAAAACTGATCCAGAAACATTCTTAAATAAAGGTGACACCAGGAGTTCTTTACTGTCAGCAACCAGGAAGTTCAAAACATCTGTTTCCTTCATAGTTACCATGGGGGCTAATGGTAACCGAAACTCAAAGTTAACGGAGCCAAATTTAATAAAGGACTGGCAACACATGCAATCAAAAGGTTGCTTCTTCTTAGAAGAAGATGGTGAAATCATTAGTCATCAGTACAGGATGCAAATAGCTCAGAGGTCCATGGTTTATCTAACAATTAAGCCATTAAACCTGAGTCAAGTTGAAGGAAAACCATCCCCTTGGTTATCCGTTGATACTGCCTTGTATATTCTCAAGGAAAATGAGAGTCAAGCAAATCTACAGCTTGTGTGTTTTACCGAACTACGAAATAGAGAAGTGTTTGGATGGACTGGTGAACTAGGACCTGGAATTTACTGGTTAATTCCTTCCACAACTGGCTGTAAGCTGAGGAAAAAAATAAAACCAGTAACAGATGAAGCCCAACTTGTATATAGAGATGAAACAGGGGAATTATTCCTTACAAAGGAATTTAAGTCTACTTTATCAGATATATTTGAAGTAATTGATTTAGATGGAAATGGTCTTCTTAGCCTTGAAGAATATAATTTTTTTGAATTGAGAACAAGTGGTGAGAAATGTGATGAAGATGCTTGGGCTGTCTGCAGAGAGAATTTTGATACAAAGAGGAATGAACTAACAAGACAAGGATTTATGGATTTGAATCTAATGGAAGCTAATGATCGAGAAGGAGATCCTTGTGACCTTTGGGTAACTCTACACTCTATGGGCTACAATAAAGCTCTGGAGTTGACAGAGGCATGTCCATTTGTCATTGATATCTATGCAGAAAAATGCAAGCCAAAAATTAAAGCTGTCCATATGGAGGCATGTAGTGGACAACTTGAGAAGGCCATTTGTAAATCTGTTCTTAGCAACGGTGATGCCAAAGTAATGGATGGCTATGAAAATATAATCGTGCATACTTACAGTTGTGACACCTGGATAACGTCAGTTATTGAAAACAAGTCAGATGAGAAAGTGATTATTCACATCAGCAATGAGCTAAGTAAAAACTGCATAAACAACAGAGGACTCAACATATTTGCAGTAGAAGTGGGACCCAAATCTACAATGGTTTGTCAACATGTAATGCCTTTGAATGAACGACAAGAATGGATATATTATTGTATATATTCTCTTATTTCTTAA

Length: 1890

View AllClose

0 Reviews

View AllClose