Human EFCAB1 cDNA Clone BC025676 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL862053HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFCAB1
Gene ID:
79645
Accession #:
BC025676
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EFCAB1 cDNA Clone BC025676 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFCAB1

Gene ID: 79645

Accession Number: BC025676

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACCGCAAGAAACTGCAGAAGCTGACGGACACCTTAACCAAAAATTGCAAGCATTTTAATAAATTTGAAGTGAACTGTCTTATAAAGCTTTTTTATGACTTGGTGGGAGGAGTAGAGAGGCAAGGTCTGGTTGTTGGACTGGATCGTAATGCATTTCGAAACATCCTGCATGTGACATTTGGAATGACAGATGACATGATTATGGACAGAGTATTCCGAGGTTTTGATAAAGATAATGATGGCTGTGTAAATGTATTGGAGTGGATTCATGGATTATCACTGTTTCTTCGAGGATCTTTGGAAGAAAAAATGAAATATTGCTTTGAAGTGTTTGATTTGAATGGTGACGGATTCATTTCAAAGGAGGAAATGTTTCACATGTTGAAGAACAGCCTTCTCAAACAGCCATCTGAGGAAGACCCTGATGAAGGAATTAAAGATTTGGTTGAAATAACACTGAAGAAAATGGATCATGACCATGATGGGAAGCTGTCTTTTGCAGACTATGAACTGGCTGTGAGAGAAGAGACTCTTCTACTGGAGGCCTTTGGGCCATGTCTTCCTGATCCAAAGAGCCAGATGGAATTTGAAGCTCAAGTATTCAAAGATCCAAATGAATTCAATGATATGTGA

Length: 636

View AllClose

0 Reviews

View AllClose