Human EEF1B2 cDNA Clone BC067787 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL335050HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1B2
Gene ID:
1933
Accession #:
BC067787
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EEF1B2 cDNA Clone BC067787 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EEF1B2

Gene ID: 1933

Accession Number: BC067787

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGTCCAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCAGGAGTGAAGAAAGCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCATCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCGATGGATGTGGCTGCTTTCAACAAGATCTAA

Length: 678

View AllClose

0 Reviews

View AllClose