null

Human EEF1B2 cDNA Clone BC000211 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL335050HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1B2
Gene ID:
1933
Accession #:
BC000211
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EEF1B2 cDNA Clone BC000211 pENTR223.1 Plasmid | Cusabio

Gene Name: EEF1B2

Gene ID: 1933

Accession Number: BC000211

Vector: pENTR223.1

Sequence: ATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGTCCAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCAGGAGTGAAGAAAGCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCATCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAA

Length: 678

View AllClose

0 Reviews

View AllClose