Human EDN1 cDNA Clone BC009720 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007400HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDN1
Gene ID:
1906
Accession #:
BC009720
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EDN1 cDNA Clone BC009720 pENTR223.1 Plasmid | Cusabio

Gene Name: EDN1

Gene ID: 1906

Accession Number: BC009720

Vector: pENTR223.1

Sequence: ATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTGTGGCTTGCCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAGAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGACCATGAGAAACAGCGTCAAATCATCTTTTCATGATCCCAAGCTGAAAGGCAATCCCTCCAGAGAGCGTTATGTGACCCACAACCGAGCACATTGGTGA

Length: 639

View AllClose

0 Reviews

View AllClose