Human EDEM3 cDNA Clone BC016464 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL863170HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDEM3
Gene ID:
80267
Accession #:
BC016464
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EDEM3 cDNA Clone BC016464 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDEM3

Gene ID: 80267

Accession Number: BC016464

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGAGGCTTTAAGTATGGTGATGAACAACCACGTTCTGACTGGCGTAGTTATCGTAGGAATCTGGAGCATGCTGTGTTAGAATTGACCTTGTTTAAAACTGTCCCATCAAAAATGGAAATCCACAGTTCCCCCTTCAAATGCAGCACTGCACCACCCTGCAACACCTCAGGCCAGGGAAAGATTACTGAGCATTCCTGCGAACCAGATTTCTGTTGTCTCTGGATAGACAAGAAACAAAATTCATTTAGTAGTGGAGTGGGGAATAGGAGTTTGGATAGCCTTCTAATTAAAGGAAGCTCGCCTTTCTTGGTTTTGGGGGTTAGAGGCTCTTTTGGGAAGATGCATCCGAGTATTGTGGCATTCTGA

Length: 369

View AllClose

0 Reviews

View AllClose