Human EDC4 cDNA Clone BC064567 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL744034HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDC4
Gene ID:
23644
Accession #:
BC064567
Plasmid:
pUC
€1,530.00
Frequently bought together:

Description

Human EDC4 cDNA Clone BC064567 pUC Plasmid | Cusabio

Gene Name: EDC4

Gene ID: 23644

Accession Number: BC064567

Vector: pUC

Sequence: ATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTGCGGGACATCCTCAAGCTGGACCGGCCCGCGGGCGGCCCCAGTGCAGAGAGCCCACGGCCATCCAGTGCCTACAATGGGGACCTCAATGGACTTCTGGTCCCAGACCCGCTCTGCTCAGGTGATAGTACCTCAGCAAACAAGACTGGTCTTCGGACCATGCCACCCATTAACCTGCAAGAGAAGCAGGTCATCTGTCTCTCAGGAGATGATAGCTCCACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCTAGCAGTGACTCTAGCATTTCAAGCAAGGCCCGGGGAAGCAACAAGGTGAAAATTCAGCCTGTCGCCAAGTATGACTGGGAACAGAAGTACTACTATGGCAACCTGATTGCTGTGTCTAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCTGCCATGGTGCGGGTGATCAGCGTCAGCACTTCGGAGCGGACCTTGCTCAAGGGCTTCACAGGCAGTGTGGCTGATCTGGCTTTCGCGCACCTCAACTCTCCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTCGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATCTTGGTCCATATTCGGCAGCCAGAGGGCACGCCACTGAACCACTTTCGCAGGATCATCTGGTGCCCCTTCATCCCTGAGGAGAGCGAAGACTGCTGTGAGGAGAGCAGCCCAACAGTGGCCCTGCTGCATGAAGACCGGGCTGAGGTGTGGGACCTGGACATGCTCCGCTCCAGCCACAGTACCTGGCCTGTGGATGTTAGCCAGATCAAGCAGGGCTTCATTGTGGTAAAAGGTCATAGCACGTGCCTCAGTGAAGGAGCCCTCTCTCCTGATGGGACTGTGCTGGCTACTGCGAGCCACGATGGCTATGTCAAGTTCTGGCAGATCTACATTGAGGGGCAAGATGAGCCAAGGTGTCTGCACGAGTGGAAACCTCATGATGGGCGGCCCCTCTCCTGCCTCCTGTTCTGTGACAACCATAAGAAACAAGACCCTGATGTCCCTTTCTGGAGGTTCCTTATTACTGGTGCTGACCAGAACCGAGAGTTAAAGATGTGGTGTACAGTATCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTGCCCCCTAGCCTCAAGGTTTGCTTGGACCTCTCAGCAGAATACCTGATTCTCAGCGATGTGCAACGGAAGGTCCTCTATGTGATGGAGCTGCTGCAAAACCAGGAGGAGGGCCACGCCTGCTTCAGCTCCATCTCGGAGTTCCTGCTCACCCACCCTGTGCTGAGCTTTGGTATCCAGGTTGTGAGTCGCTGCCGGCTACGGCACACTGAGGTGCTGCCTGCCGAAGAGGAAAATGACAGCCTGGGTGCTGATGGTACCCATGGAGCCGGTGCCATGGAGTCTGCGGCCGGTGTGCTCATCAAGCTCTTTTGTGTGCATACTAAGGCACTGCAAGATGTGCAGATCCGCTTCCAGCCACAGCTGAACCCTGATGTGGTGGCCCCACTGCCCACCCACACTGCCCACGAGGACTTCACATTTGGAGAGTCTCGGCCCGAACTGGGCTCTGAGGGCCTGGGGTCAGCCGCTCACGGCTCCCAGCCTGACCTCCGACGAATCGTGGAGCTGCCTGCACCTGCCGACTTCCTCAGTCTGAGCAGTGAGACCAAGCCCAAGTTGATGACACCTGACGCCTTCATGACACCTAGCGCCTCCTTGCAGCAGATCACTGCCTCTCCCAGCAGCAGCAGCAGCGGTAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCTCCCTTACAGCTGTGTCTGCCATGAGCAGCACCTCAGCTGTGGACCCCTCCTTGACCAGGCCACCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGCCTGACAATGAGCAGCAGTGGCAGCCTTCAGGCAAGCCCGCGTGGCCTCCTGCCTGGCCTGCTCCCAGCCCCAGCTGACAAACTGACTCCCAAGGGGCCGGGCCAGGTGCCTACTGCCACCTCTGCACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAAGCCTCCCCTAGCCGCACTCGTTCCCCTGATGTCATCTCCTCAGCTTCCACTGCCCTGTCCCAGGACATCCCTGAGATTGCATCTGAGGCCCTGTCCCGTGGTTTTGGCTCCTCTGCACCAGAGGGCCTTGAGCCAGACAGTATGGCTTCAGCCGCCTCGGCACTGCACCTGCTGTCCCCACGGCCCCGGCCAGGGCCCGAGCTCGGCCCCCAGCTCGGGCTTGATGGAGGCCCTGGGGATGGAGATCGGCATAATACCCCCTCCCTCCTGGAGGCAGCCTTGACCCAGGAGGCCTCGACTCCTGACAGTCAGGTTTGGCCCACAGCACCTGACATTACTCGTGAGACCTGCAGCACCCTGGCAGAAAGCCCCAGGAATGGCCTTCAGGAAAAGCACAAGAGCCTGGCCTTCCACCGACCACCATATCACCTGCTGCAGCAACGTGACAGCCAGGATGCCAGTGCTGAGCAAAGTGACCATGATGATGAGGTGGCCAGCCTTGCCTCTGCTTCAGGAGGCTTTGGCACCAAAGTTCCTGCTCCACGGCTGCCTGCCAAGGACTGGAAGACCAAGGGATCCCCTCGAACCTCACCCAAGCTCAAGAGGAAAAGCAAGAAGGATGATGGGGATGCAGCCATGGGATCCCGGCTCACAGAGCACCAGGTGGCAGAGCCCCCTGAGGACTGGCCAGCACTAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAGGAAGAGCTGCTGCAGCGTCTGTGTACCCAACTCGAAGGCCTGCAGAGCACAGTCACAGGCCACGTAGAACGTGCCCTTGAGACTCGGCACGAGCAGGAACAGCGGCGGCTGGAGCGAGCACTGGCTGAGGGGCAGCAGCGGGGAGGGCAGCTGCAGGAGCAGCTGACACAACAGTTGTCCCAAGCACTGTCGTCAGCTGTAGCTGGGCGGCTAGAGCGCAGCATACGGGATGAGATCAAGAAGACAGTCCCTCCATGTGTCTCAAGGAGTCTGGAGCCTATGGCAGGCCAACTGAGCAACTCAGTGGCTACCAAGCTCACAGCTGTGGAGGGCAGCATGAAAGAGAACATCTCCAAGCTGCTCAAGTCCAAGAACTTGACTGATGCCATCGCCCGAGCAGCTGCAGACACATTACAAGGGCCGATGCAGGCTGCCTACCGGGAAGCCTTCCAGAGTGTGGTGCTGCCGGCCTTTGAGAAGAGCTGCCAGGCCATGTTCCAGCAAATCAATGATAGCTTCCGGCTGGGGACACAGGAATACTTGCAGCAGCTAGAAAGCCACATGAAGAGCCGGAAGGCACGGGAACAGGAGGCCAGGGAGCCTGTGCTAGCCCAGCTGCGGGGCCTGGTCAGCACACTGCAGAGTGCCACTGAGCAGATGGCAGCCACCGTGGCCGGCAGTGTTCGTGCTGAGGTGCAGCACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCCATTTTAGCACAGGTACAGCGCATCGTTAAGGGTGAGGTGAGTGTGGCGCTCAAGGAGCAGCAGGCCGCCGTCACCTCCAGCATCATGCAGGCCATGCGCTCAGCTGCTGGCACACCTGTCCCCTCTGCCCACCTTGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCGCTGACAGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGCCCAGGTTTTTGGGCAGCCACCCTGCCCGCTCTCCCAGCCTGTGCTCCTTTCCCTCATCCAGCAGCTGGCATCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCCGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGCTCCGTTATGGCCCAGGTGCGCCAAAAGCTTTTTCAGTTCCTGCAGGCTGAGCCACACAACTCACTTGGCAAAGCAGCTCGGCGTCTCAGCCTCATGCTGCATGGCCTCGTGACCCCCAGCCTCCCTTAG

Length: 4206

View AllClose

0 Reviews

View AllClose