Human EDC3 cDNA Clone BC011534 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822210HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDC3
Gene ID:
80153
Accession #:
BC011534
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human EDC3 cDNA Clone BC011534 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDC3

Gene ID: 80153

Accession Number: BC011534

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTACAGATTGGCTGGGAAGTATTGTGTCCATCAATTGTGGAGATAGCTTGGGTGTCTATCAGGGAAGAGTGTCAGCTGTGGATCAGGTCAGCCAGACCATTTCTCTCACCCGGCCTTTCCATAATGGAGTGAAGTGTCTTGTTCCAGAAGTCACCTTCAGGGCAGGTGACATTACGGAGTTAAAAATTCTGGAGATACCAGGACCTGGAGACAACCAACATTTTGGAGACCTTCATCAAACAGAATTAGGCCCCTCTGGTGCTGGCTGCCAAGTGGGCATCAATCAGAATGGCACAGGCAAGTTTGTCAAGAAGCCAGCCTCTTCCAGCAGTGCCCCTCAGAATATCCCTAAGAGGACAGATGTGAAGAGCCAGGATGTTGCCGTTTCCCCGCAGCAGCAACAGTGCTCAAAGAGCTATGTCGACAGGCACATGGAATCCTTGAGTCAGTCCAAAAGTTTCCGTCGTCGGCACAACTCCTGGTCATCTAGTAGCAGGCACCCAAATCAGGCAACTCCCAAGAAAAGTGGTTTAAAGAATGGCCAGATGAAGAATAAAGATGACGAGTGCTTCGGGGATGATATTGAGGAGATCCCAGACACAGATTTTGATTTTGAAGGGAACCTGGCTCTTTTTGACAAGGCAGCTGTGTTTGAGGAGATTGATACCTATGAAAGGAGAAGTGGTACCCGTTCCCGGGGCATCCCAAATGAAAGGCCCACTCGGTACCGCCATGATGAGAACATCTTGGAGTCCGAGCCCATTGTCTATCGACGGATCATAGTGCCCCACAACGTGAGCAAGGAGTTCTGCACGGACTCTGGCCTGGTTGTCCCAAGTATTTCCTATGAGCTGCATAAAAAGCTGTTGTCCGTGGCTGAGAAGCATGGGCTGACCCTTGAGCGGAGACTGGAGATGACAGGTGTGTGTGCCAGTCAGATGGCACTGACCCTCCTCGGAGGACCTAACAGGTTGAATCCCAAAAATGTTCACCAGAGGCCTACAGTGGCTCTACTGTGTGGACCTCATGTGAAGGGGGCTCAGGGTATCAGCTGTGGAAGGCACCTAGCCAACCATGATGTCCAGGTCATCCTTTTCCTGCCCAATTTTGTCAAGATGTTGGAATCTATCACCAATGAGCTGTCGCTCTTCAGCAAGACCCAAGGCCAACAAGTGTCTAGCCTCAAAGATCTGCCCACTAGCCCTGTGGACCTGGTCATCAACTGCCTGGATTGCCCTGAGAACGTCTTCCTGCGCGATCAACCCTGGTACAAGGCAGCTGTGGCCTGGGCCAACCAGAACCGGGCACCAGTACTCAGCATAGACCCTCCTGTGCATGAAGTCGAACAGGGCATTGATGCCAAATGGTCACTGGCACTGGGCCTGCCTCTGCCACTGGGGGAGCACGCAGGCCGTATCTATTTGTGCGACATTGGCATTCCCCAGCAGGTCTTCCAGGAGGTGGGCATCAACTACCACTCGCCCTTTGGCTGCAAGTTTGTTATCCCACTGCACTCTGCTTAG

Length: 1527

View AllClose

0 Reviews

View AllClose